Transcript asmbl_112655

Sequence
Transcript Sequence for observation asmbl_112655 of TGE0004845:
CGCAGCCGCCAATGGGAAGGGAGCGAGTGCCATGAACAGGCCAATAAGGAGGGAGCGGTGCGGGGTTTAAATCTGAGGCAAGGCCCTGCATCTCCCAGCGTGCTGCAGAGGAACGGCTGTTGATCTGTGTTGAATTCAGGTCCCCGGCTTGTCGGGGGCTCGAGTTCTCGGCTTCTCTCCTCTGAGCTGCTACCTGTTGAAGAGGAAGCCATGGCGTTCCGGGTCACCAGGAACACGAAAATTAATGCTGAAAATAAGGTGAAGATCAATATGGCAGGCGCAAAGCGCGTGCCTGTGTCCACTGCTGCAGCCTCCAAGCCGGGCCTGAGACCAAGAACCGCCCTTGGAGACATCGGTAACAAAGTCAGTGAACAGCCACAGGCCAAATTACCTCTGAAAAAGGAAGCAAAAACTTTAGCTGCTGGAAAAGTTATTGCTAAAAAAGTACCTAAACCTCTGGAAAAGGCACTGGAGCCTGTGCCTGAGCCTGCGCAGGAGCCTGTGCCGGAGCCTGCATCAGAGCCAGAACCTGAGTCTGTTAACAAAGAAGAAAAACTTTCTCCTGAGCCTATTGTGGTTGATACTCCCTCTCCAAGCCCAATGGAAACGTCTGGATGTGCCCCTGCAGAAGAATATCTGTGTCAGGCTTTCTCTGATGTAATTCTTGCAGTGAACGATGTGGATGCAGAAGATGGAGCTGATCCAAACCTTTGTAGTGAATATGTAAAAGATATCTATGCTTATCTGAGGCAACTTGAGGAAGAGCAAGCAGTCAGACCAAAATACTTACTGGGTCGTGAAGTCACTGGAAACATGAGAGCCATCCTAATTGATTGGCTAGTGCAAGTTCAAATGAAATTCAGATTACTGCAGGAGACCATGTACATGACTGTTTCCATTATTGATCGGTTCATGCAGAATAATTGTGTTCCCAAGAAGATGCTGCAGCTGGTTGGTGTCACTGCCATGTTTATTGCAAGCAAATATGAAGAAATGTACCCTCCAGAAATCGGTGACTTTGCTTTTGTGACTGACAACACTTACACTAAGCTCCAAATCAGACAGATGGAAATGAAGATTCTAAGAGCTTTAAATTTTAGTCTGGGTCGCCCTCTACCCCTGCATTTCCTTCGGAGAGCATCTAAGATTGGAGAGGTTGATGTGGAGCAACATACTTTGGCCAAATACTTGATGGAACTAACGATGTTGGACTATGATATGGTGCACTTTTCTCCTTCTCAGATCGCAGCGGGAGCTTTTTGTTTAGCACTGAAAATTCTCGATAATGGTGAATGGACACTAACTCTACAGCATTACCTGTCATATACTGAAGAATCCCTTCTTCTTGTTATGCAACACCTGGCTAAGAATATAGTCATGGTGAATCGTGGACTTACAAAGCACATGACTATCAAGAACAAGTATGCCACAGCTAAGCATGCTAAGATCAGCACTCTTGCACAGCTGAATTCTGCACTAGTTCAAGATCTGGCCAAGGCTGTGGCAAAAGTGTAACTTGTGAAATTGAGTTGGAGTACTGTAATGATCTGCAAATAAAATTGGCACCATGTGCTATCTGTATATATTACATGTTACATTTATTTACTTTTAATAAAGTTGTGGACCTTTTTACTTCTTACCTTAACTCATTTGAATGTGGCCACTTCCTGCTCTTGGGGAACCCTAAAAGTAGCCTTAAAGATATGCTAGGGAATATAGAGTATTAAAAAAAGCGCTTTCAGTTAAACTAGGGACCCAACTAATATATATAATTGTTGCTTATATGATTCTTGTTTTATATACCTACCTGGATTTTGCTTTATAAATAGGAATTACTAAGGTTATGAAGGCATTTAAAACCCTTACCTTCCATAGGGCATACTGCATGTAAGCCTAGTCATCTTGGAGCATCTGCTGCCTTGTTCTACTTAAGTAAAAGTCTGCCACCTCATCCCTAGTCCGCCATTTTCTGTTTCTTCTGGTGTTTGCTGCCATAAATTCTAAGTAATCTACTTTTACCACTATTTCTTAAATTATCAACTTTAGTATCAACTTTTTCACTTGGAAAAATGACTTTATATTCTAAACATACTTTACTTTTTCTTTATTAGTTGAGAAAATAAAACAGACTCCTCAAAACATACCAAAGTATCTTAAAAAGTTTATTTTACCTCTCCCCGCAACTCTCCTACATCTCCACGCCCTCGACCTGAAGATGTCAACAGTTTGAGATGTAGCCTTCCATGACTTCTATAAACATAGATGTGCATAGATATAAATTGTCATGGAGATTTTAAAACATAAGATTTTTCTACATGCTTAGCAATTCCTTTCAATATGTATAGACATCTGTTTTAGGGTATTACGTTCCAGAGTATAATGTATTCAGTCATTCAATTGACATTTGGATGGCTTTTTTCTTTGCCCCTAAAGACAATGCTGTTTAAATATCATTAAGTATCATGTTGGTTTTTTGGGGGTTTTTTTTACATAAATTGGGTTCTCCAAAGGGTATGTGTGTTCTCACTTAAAGCAGGTCCTGTCAAATGACTTTCTCAGTGTCATCAGCAATGTACAAAAGTGCTGGTTTTCTCTGCAGTTTTGTCAAAACTAAAGATAATCTCTTTAATTTCTGTGAATTTGGGAATTCTACCTTGTTTGCTGTTTTAATGTATACTCCTAATGATTACTTGAATAAATTTTTGTTGTCTACTAACTTTTCAATGTGTAAGCCTTTCCCAGTTTGTTATTTGCCCTTTGACTATTAATGCTGTGTTGCCATGCAAACATTTTAAGTTTTTATATTATCAAATCTATTTTTTCCTGTAGTTGCTTTTGGATTTTCAGTGTTAAAGTCAACTTCCTCCCAAACTATAAATATCCTCCAAGAAATTTTGTTCCCATTTATATTTATGATCCCTGTGGTATGAGGTGGGATTCTTACTTCCAGATAAGTGCCCATTCATGCCCATATAATTAGTCATCCTTGTCCAGCTGAATTGAAATATCAACGCCCGTCTATTGTTCCCTGATCTTTTTTTCCTGTGATAAACTTGATTATATTACCTGGTAAGATGGGCTACCACTATTTTTCAAATATATATAAACTTTAAAATTATGTCCAGTTAATTGAAAAGCTTGAGATTTTGACTACATTATGTGCATAAGTGCAATATATTATGTACTAGTTTGGGATGGACTGATATATTGCCCTCCCGTCCAGAAGCGTTTTTCTCCATCAAGGTGTTTCACATGTCCTTAATATGTTAGAATTTAATTATATAGCTGCAATTTTCTTGTAAAGTTTATTATTGAGTTTATGGGGTTTTTGTCACTATTATAAATAGGATCTATTGCTAGTTGTCTTTTATTATTCAGCTGACATCAATTTTCTTGATTTGTTTTTAGTGGAGATTTCTAAACCTTAAATCCAAAAAGTATTTTTTTCAATGTTTATGGTATTGTATTAGAAGCTCCAAAATAATCCTTGATTATAGGTAGATCCTTGTCTTGTTCCTGAACTAGACATCTCTTAAGTATTTTTACCATTTAATATTTTCACTGTTAATCTGTAAGTGGTTTTTATATTTTAGGTATTTTTCTATTCTTGTTGAGAAATGTTACAGGCAAGGCTGTGGAATTTCACTTAATTTTTTTTAGTTTATGATATCATTAGGATTTTTCTCTTTTAACTTGATAAAATATTCCATGTTAGAGGTTTCCTAAAGTGGAATGAGTTCTTGTGATATATAATCTGCTAATGTTTCCTTTAAAAATTTTTGCATTTTATTTGAGAAATTGGCTCAGTTTTTGTTATTGCTACCATTTTCTGTTTTTTTACCGGAGGTGGATTAAAGATTTTCATCTTCAAGACTTTATAATTTGAAGTCTTTATTCATTCATTGAAAACTATCTACTTCAAACTAAAGTCATTTGGTCTGGAGCTGCTTAAAATAGTTTTTTATGGTCTTTTGGTCTTTTAGGAATTCTTCCTCTTCCCCCAATATTAGAAAATCATCTATCTCGGTTTTTAAAATTATAGCGGTAGAGGTAAATGATATAATTAGTCTTTTCTGTATTATAGTTATATATTCTTTCTCATTCCTGGTATTAAATACTTTTGTTTTCTAATCAGACTTGCCCATGGGGGTTTTGTTTCGAAATAATCAGCTTTTGGTGTTATTTCTACCACCTTTAATTTATAGTTTTAGCTTTTATATTACTTTTATCTGTTTTTCTTTTGGTTATTTTCTAATTTAAGTTAAATGCTTAATGTATTTTAGTAATAAAAGCCTTTATACATTTTCCTCTGA