Transcript asmbl_110571

Sequence
Transcript Sequence for observation asmbl_110571 of TGE0004810:
CAGGAGTTACTGGATCCTGAAGACCATCCCTGGATCTCGGGTTAAAAATCTGTTCTAATCTGAACCGTGGGAAGAAAGGGTCCTTGGTCGGCGGTATTCCCACCTGAAGGACATGATGTTTTCCAAACTAGCACATTTCCAGACCGTTGCCGTGCTGCGTCGAGGAGTTCACTCTTCAGTGGCTTCTGCTACATCCGTTGCGACTAAAAAAACAGTCCAAGGCCCTCTATCCTCTGATTACGTTTTTGAAAGGGAATCGAAATATGGCGCACACAACTACCATCCCTTACCTGTAGCCCTGGAGAGAGGAAAAGGTATCTACCTGTGGGATGTAGAAGGCAGAAAATATTTTGACTTCTTGAGTGCTTACAGTGCTGTCAACCAAGGGCATTGTCACCCAAAGATTGTGAATGCTCTGAAAAGTCAGGCAGACAAACTGACCTTGACATCTAGGGCATTCTATAATGATGTACTTGGTGAATATGAAGAGTATATTACTAAACTTTTCAACTATCACAAAGTTCTTCCTATGAATACAGGAGTGGAGGCTGGAGAGACTGCTTGCAAGCTTGCTCGTAGATGGGGATATACCGTTAAGGGTATTCCGAAATACAAAGCAAAGATCGTTTTTGCAGCTGGAAACTTTTGGGGTAGAACTATGTCTGCTATCTCCAGTTCCACAGACCCAAACAGTTACGAAGGTTTTGGACCATTTATGCCAGGTTTTGAAATCATTCCATATAATGATCTGCCCGCTCTTGAGCGTGTTCTCCAGGACCCGAACATCGCCGCATTCATGGTGGAGCCCGTTCAGGGCGAAGCGGGCGTCATTGTGCCAGACCCGGGCTACCTGACAGGCATCCGTGAGCTCTGCACCCGGCACCAGGTTCTGTTTATTGCTGATGAAATACAGACAGGATTGGCCAGAACTGGTAAATGGCTGGCCGTCGATCATGAAAATGTCAGACCTGATATAGTCCTTCTTGGAAAGGCGCTTTCTGGTGGCTTATACCCTGTGTCCGCAGTACTGTGTGATGATGAAATAATGCTGACCATCAAACCAGGGGAGCATGGGTCAACGTTTGGTGGCAACCCGCTGGGCTGCCGAGTGGCCATGGCAGCCCTCGAGGTTTTGGAAGAAGAAAACCTTGTTGAAAATGCAGATAAAATGGGTACCATCTTGAGAAACGAACTCATGAAGCTACCATCTGATATCGTAACTGCTGTAAGAGGGAAAGGATTATTAAACGCTATTGTTATTAGAGAAACCAAAGATTACGATGCTTGGAAGGTGTGTCTGCGACTTCGAGATAATGGACTTCTGGCCAAGCCAACCCACGGCGACATTATCAGGTTTGCACCTCCGCTTGTGATCAAGGAAGACGAGGTTCGGGAGTCCATGGAAATCATTAACAAGACCATCTTGTCTTTCTGAGGGTTGCGACTGTTTTCGGCGGTGCCTGTGAGTCAGCTGGAGACAGGCAGACAGTTCCTTGAAGTCCTGTAAAAAGCTTCTGCATTTTTGTGTGTGATGCAGGCACATTCCACTCCCTGTGTCTTCAAGGACTTATTTTTTAATATACATATTTTTCAGTTCATACATAATAGAGTGACATTTATAATCGTGCAGTATGCCATTTAACATAACTGTAAGAGAATGTAATGACATCTATATTCGATTGTTTTTGTGTACTTGTGTACTTTCTGAAGTGAAATGCATCTATTTGTCTGTCTGTAGGCAGCCTTACAATCAAGCCCCATATAACTTATATATGTTTTTATAATTTCTGGTGTAAATGTTTTATATTTGAAAAAGTTATATGGGGTTTTACATAAAAGACTTCTTTAACCTTATGAAGCTGAATTATAATCATTGAATTTTAGGAAGGTTAAGCTTATATAAAACACTAGATTTAAATAAACTTCATATTGGCCAACATCAGAATATATTCCATGAGTGTCATTATTTTGAATTAATAATTAATATTTAACATTCCCAAATTATTTTTTAAGCGCTGATATAACTTATAAAATATATTTTCAGTTTTTTAAAACTTCAAAATAAAGCTTATATT