Transcript asmbl_108654

Sequence
Transcript Sequence for observation asmbl_108654 of TGE0004797:
GGGGCCGCGGGGTGAGCCAGCGGGGGAGGCTGACATCACCACAGCAGCAGTCTTTAAACCCCTCATCCAGCCAGCGCCCCATCCTGTCTGTCCAAGTCCAGACAGAGCTGACTCCTTCCTTCAAGCCTTGAAGAGCCCCTCTCTCCCTAAACATGGCCAACAAGGGACCTTCCTACGGCATGAGTCGTGAAGTGCAATCCAAAATTGAGAAGAAGTACGACGAGGAGCTGGAGGAGCGGCTGGTGGAGTGGATTGTGGTGCAGTGTGGCCCTGACGTGGGTCGCCCAGACCGCGGGCGCCTGGGCTTCCAGGTCTGGCTGAAGAACGGCGTGATTCTGAGCAAACTGGTGAACAGCCTGTATCCTGATGGTTCCAAGCCAGTGAAGGTGCCTGAGAACCCCCCTTCCATGGTCTTCAAGCAGATGGAGCAGGTGGCTCAGTTCCTGAAGGCAGCTGAAGACTATGGAGTCACCAAGACTGACATGTTCCAGACTGTTGACCTCTTTGAAGGCAAAGACATGGCAGCAGTACAGAGGACCCTAATGGCTCTGGGCAGCTTGGCAGTGACCAAGAACGATGGGCACTACCGTGGAGATCCCAACTGGTTTATGAAGAAAGCCCAGGAGCATAAGAGGGAATTCACAGAGAGCCAACTGCAGGAGGGAAAGCATGTCATTGGCCTACAGATGGGCAGCAACAGAGGGGCTTCCCAGGCTGGCATGACGGGCTACGGACGACCTCGGCAGATCATCAGTTAGAGGACGAGGGCCAGCCCCCAGTCCTTTCCTGCCCCGGCTCATTGGCTGCAGCCATCTATCCTGCCTAGCCCACCTCACCCACACCCGTGTAATTCCTTCAGCCCCGGCCAAGCTTCGAGTCTCCGAGGCTCTGTCACTGAGCAAAGGTGACTTGCGCTTGGGCAACTCTCCCCACCCTCCTCAGCCTCAGCTGAACTTCTTACCCCAAAGCACTGCTCCCTGGGCCCTCCTTCAACCTCCCACCACCTCTACTGAGCTGAGCAAGGGGGTGTGGGCTGGGGGTGGTCTGGGTGTGGGGCAAGTCCACTGCGCTCCTTGGCAGCAGATGCCCATTGAAGGAGACCCAGCCCAACCTCCCCCCATTTTTTGCTGGAATATTTTGGGGGTTGAAATTCAAGAAGGAAAAAAAAATATATATATATATCTATATCTATCTATCTATCTCAATCTTTTCTCGGGCCTGGCTGGTAGAGTTTGATTTGCCCTAGTCACTTCCGTGTGGTTTCGGGAAATACAAACAGGGAACAGGGCCACCTGTGTTGTCCTGGTTGCCATCCTCTGAAGGACTCTTCACATTCCAGGATTCCAGGGGGTCAGATTCTTTCAGACAACCAGGCAGTGGAAGAAAGTGAATCTCTGGGGGACTGACAGGAAGGAGGAACTACTTGGCAACTTGCATTAGCTCTGGGGAGGCAGAGGAAAGGAGATGCAGAATGGCAGAATTGTGTGGAAGGTTTTTATTCTGGAAAAGCTGTGCAGAAAAAAATTCAACGAAATGTTGCTGTGAAGAGAAAACCAAGCCTTAAGTGTTCACTTTGCAGAGGAAGACAGGATGGTAGCAGGGTTGGGGCAGCAGTGGCTGATACCTGCCACAGTCCTGAATAGACTCCCCTAGTGAAGCAGCACAGCCCTAGGTGCTGTGCCCATTCCCAGCTTTGCCAGGAGCACTGTACCGGTCCTTCGGGATGAAGGGTGGGGGTGATGGTGAAGGAGTCAGGGGTGTGTTCATGGTTGGCTTCTGATCAGGCAGCTGCTTTCAGGGCAAGTGTGCTGGGCTGAGAGCTGA