Transcript asmbl_108517

Sequence
Transcript Sequence for observation asmbl_108517 of TGE0071088:
CGCGACCGCGCTTGTCCTCCGCGGCTTGCCGTCTTCGCGGCCATGGCGGCCGCCGCTGCGCCACGCGCGTGGCTGGCCCTGCAGCCGGCGGCCAGGACCCTCCGTGCCTTCTCCAGCGCCGTTTCTCCGGCCACTGTTGCCCAGAGTTCAAGACCGCATACAACAGAAAGAACGTCCAAATCTCAAAGGCCACTGAAAAGAAAGGCACTACCTCCTAGGACAGAGAAAATGGCTGTTGACCAAGATTGGCCTAGTGTTTACCCTGTTGCAGCACCATTTAAACCCTCTGTAGTACCTCTTCCTGTTCGGATGGGTTATCCGGTAAAGAGGGGGGTGCCCATGGCAAAGGAGGGAAATCTGGAACTTTTAAAGATCCCCAATTTTCTGCATTTGACTCCTGTAGCAATTAAAAAGCACTGTGAAGCTCTTAGAGATTTTTGCACTGAGTGGCCAGCTGCACTAGACAGTGATGAGAAATGCGAGAAGCATTTTCCAATTGAGATTGACACAGCTGATTATGTTTCATCAGGACCATCTATTCGAAACCCCAAAGCACGAGTAGTCACCTTAAGGGTTAAACTTTCCAGTTTGAATTTAGATGATCATGCAAAGAAGAAACTTATTAAACTTGTAGGAGAGCGATACTGCAAGACCACAGATGTGCTTACTATCAAGACAGATAGGTGCCCTCTAAAGAGACAGAATTATGATTATGCAATGTATCTGCTAACAGTTTTATACCATGAGTCTTGGAAAACTGAAGAGTGGGAGAAAAATAAGACCGAAGCAGACTTGGAAGAGTATATATGGGAAAATAGCTCATCAGAAAAAAATATCCTGAAAACACTTCTGCAAATTAAAGCCGCTGAGAAAAATCTGGAAGTAAATAAGGAAGAGCTCCTTGGTACTAAAGAAGTTGAAGATTACAAAAAGTCTGTTGTTAGGCTTAAGAATGAGGGGGACAATGAAAATACCCTTTCTCACTACAAAGAATCAGTGAAGAGACTATTAAATCTGACATGAATTATGTAGAAAAATCTGCTTGCTCTATTAATTTTATGATCTATATGTGATTGTTGTCTAATTCAATATAAAGTTGAAAATGTTAAAAAAAATTGTTTTACTTCAGAGTTAAAATTATTTCATACTAATGCACAGAGGCAATGATTATTCACACATTTTCTTATTTATACACTGGGGTGATTAGACAGTTGGATCTCTGTTTTCTTCTGGTTCTAAAGTGTTTTGATTTTATTCCTACCATAACAACTTTAGTATTATAATACATACATATTATAAATTATTCATGTAGTTATTTTGTCACCTGCTACATTTGTTTCCTTATAAATTAGCACTTACTGGTTACTTTTGAATTATGATTTCTGTCATTTGGGACGCGAGGCCTAGAACACAGTCCCTGTTCAGTGTACATAGCTGCTGTCTATCCAGTGCATTTTTGCAGATGCCAATTCCGATTAGAAGCAGGTCTTACTTGTTTTTTCTTACCTAAAAAGTTGGTTCCATCATTCTACTTTGGAGTCACTTTATGTTGCTTCAACTTTGTTTAATATCCTACTTTCTATTTTCTGGAGCTTATTTCTCCAAACCCAAGCTTACAGAAAAGTGGAAATGGAGATTAACTGGTATTCATCTCTCGATTCCCCAGTTAGAGCTTCCACAGCTCAGGAAAGAGATGAGGTATAAGGACCTTGAGCTTAATTGGAGTAAATGACAAAATGAGAATTGCCCTAAGAAACATTCCATTCAATTTAGCTGTCAGTGTTTTTAGGTATATCTGTAAGTCATTTTTTACCACTTCCAAAGTTGTCCTCAAGTGATTAAAATCAAAATAAAGGAATTGTTGAGTTTGTTATTCGCCTAAGGTTTATTTTGCCTGACAGAATTAGAGAACATAAATAAAAGCCAAAAGGAATTTCAGAACAATTATACAAAGATTTATACAAGTTGAAGGTATGATTTGGTATTAGAGATATATAGGTTAGAAAGGACAACAGTAGGGCCTTGAGTACAAAAAAGAGGGAGAGGTAGGTTGTATTTTCATTGGATGGAACTAGGGAATGAAAAGCAAAGTAGGTAAAACTGAATTTTTAGATCAGATTTAAAACAAAATGTTTGAATTGTTATGTTTTTAGAGACTCATATAGAGTTAAGGAAGACTCAGGTGCAGAAATGGGATTAAAGATGGAAACATTTTGAAGGAACGTGAACAAGTAGATTAATCAGTCCAGTAGTGTTAATACACAGATGCAAATGGAAGGAGTAATGATGTATAATAAAGAATTTGACCTTTCCCAAAGCTCTGGTCTCTTCCCTCAGCTTCTGGGAAGTAATCTCTGTCACACCTCATAGAAGTGTCTTTGTTTGGGGCTGAGCCGGTCACAATGGAATTTAGGGTGGGGGCTTCGAATCACCTGGTAAATCAGTCCACCTGGCAGCTAAGATCAACCACCCAGGTAATCAGTCATACCTACGTAATGGAGCCTCAATATAAACGAACACTGAGGCTCAGGCAAACCTAACTAGTTGGCAGTATTGTGGGCGTACTGTCACGTGCTGGCACTGGGAGGGTAATGTGTCCTATCTCGGGGAGGGGACACCAGAAGCTATGAATTTGCAAACCTCCGGGACTTTATCCTATGTGTTTCTTCCTACGACTGATTTTAATCCATGTGCTTCCCTTGTAATAAACGACTGTGGTGAGTATAACAATTCTCACTGAGTTCTGTGAATTCTAGCAAATTAATGTAAGGGTGATTTGGGGACCCCTGACCCACCTCAAACTTACAGTTGGTGTCAGAAATGAGGGTGGTCTTGCACAGAGCTGAAATACCTAGAGCTCGTATTTGTACCTGGGAAAACAATGTATACAGGTGGAGGGTGTAAACTAAAACTCCCAAGCTTTATGAAACAGAAATCAATACAAAACAAAGATCTCAGTGCCATAATTATTGAAAGATGTTTTAAAAATGCAAGTGCTGGATTAGGATTGAGAAGGATTAATTAAAGGAACATAGAAAACTATATAAAAATCAGGAAGCATTTGCTCATGAGTTAGCAACCAATTATTTATAGTGTTCTTTTGCTCAAACCACTAAAATTTTATTAACGTGACAATAATTTGATTTTGACTGGAGACAAGATACGGTGGTCTTTTCCTCTATATCTTTTTTCTGTGCTTATTAAGAAAATGGAAGCTTTGAGTCTAACCGATTCTGAGCATGGACTTTTGGACCAGGCTGGCTGTTAAGTACTGGCTTCACTACTTACTCACTAGCTGTGTGATTTTAGGCAAGATACTTAGTCTCTCTTCTCGGTTCCCTCATCTGTATAATGTGATAATAATAGTATAATGGTTGATAATAGTATACTTAACACAGAATTGTAAAGATTCAATGAGTTAATGTATGTACATTACTTAAAACTATCTTGCACGTGATGCTGCG