Transcript asmbl_108296

Sequence
Transcript Sequence for observation asmbl_108296 of TGE0004781:
GGTGGGGAATCCACCAGTCATTGTTGCATCAAATGAACTTTATAACTGAGATGATAAAAATGGAAAATTCAGTTTTATTTTTAAAAACATTCCGAAGAAACAGTATTATCCCAGGGGAACACACCACCAACACCTTAGCTAGAAACAGTGGTCCACTAAAGTTGACCTGAAAAGCAAAATTAAATTTTCTTTTCTATTCGGATTAAATCTAGTTGAACAAGAGCCTGAAAGTCTAGAAGGGGCGAAGATGGTCAGGTTTTAGAAATAACGCGGCCTCTGTGTTTGAGAGCCTGCCGACTGTGAGACGGGCTGAAAGCGGAGGCCGCCTTAGCCACCAGAAGGTGACCTGCTCGTTTGGGGAGGAGGAGGGAAATGTGCACACTTGAGCCCTTGTCCTTGAAGGGGATTGAGCGAGGCGAGCGGAGGGGTAGGCGGTTCTCGGGTTTCCAATCACAATAGAGAAAGCTAAGAGGCTGCGGAGGGGGCGGGCCCGGCGTCCTCCCTCCTTGCAGATCCTGCGCCTGAAGAGACGCAGGCAGCTGACATTGTCTTCTTCGCGCGACTCTTTCTGCAGTCTGGAGAGTCCTCGGCCTCCTGTGCACAATGGCAACTCTTAAGGAAAAACTGATTGCACCAGTTGCAGAAGAGGCAGCGGTCCCAAACAATAAGATCACTGTAGTGGGTGTTGGACAAGTCGGTATGGCGTGTGCCATCAGCATTCTGGGAAAGTCTCTGGCAGATGAGCTTGCTCTTGTGGATGTTTTGGAAGATAAACTCAAAGGAGAAATGATGGATCTGCAGCATGGGAGCTTATTTCTTCAGACACCTAAAATTGTGGCAGATAAAGATTACTCTGTGACTGCCAATTCTAAGGTGGTGGTGGTAACTGCAGGAGTCCGCCAGCAAGAGGGAGAGAGTCGTCTCAATCTGGTACAGAGGAATGTTAATGTCTTCAAATTCATTATTCCGCAGATCATCAAGTACAGTCCTGACTGCATCATAATTGTGGTTTCTAACCCAGTGGATATTCTCACATATGTTACCTGGAAACTAAGTGGATTACCCAAGCACCGTGTGATTGGAAGTGGATGTAATCTGGATTCTGCTAGGTTTCGTTATCTTATGGCTGAAAAACTTGGCATTCATCCCAGCAGCTGCCATGGATGGATTTTGGGAGAACATGGCGACTCAAGTGTGGCTGTGTGGAGCGGAGTGAATGTGGCAGGTGTTTCTCTCCAGGAACTGAATCCAGAAATGGGAACGGACAATGATAGTGAAAATTGGAAGGAAGTGCATAAGATGGTGGTTGAAAGTGCTTATGAAGTCATCAAGCTAAAAGGATACACCAACTGGGCTATTGGATTAAGTGTGGCTGATCTTATTGAATCCATGTTGAAAAATCTATCCAGGATTCATCCAGTGTCAACTATGGTGAAGGGGATGTATGGCATTGAGAATGAAGTCTTCCTGAGCCTTCCATGTATCCTGAATGCTCGGGGATTGACCAGTGTTATCAACCAGAAACTGAAGGATGATGAGGTTGCCCAACTCAAGAAGAGTGCAGATACCCTGTGGGATATCCAGAAGGACCTCAAAGACCTGTGACTTCAGGCTTCTCGGCTGTAGAAATTTAAAAACTACAATGCAATTAACCATGAGCCTTTAGTTTCCAATTATGTACATGGATCACAGTTTGCTTTTATCTCCCTAAGTATGTGAATCTGGGCTCACAGAATCAAAGCCCATGCTTGATTTAATGCTTGCAATATGAGTCCTTGAACAAATAAAATTAACTATCATAGTGTG