Transcript asmbl_108278

Sequence
Transcript Sequence for observation asmbl_108278 of TGE0004778:
TTGCTAACTTCCTTCCTGTTCTAACTGCCAGTACTCAGAAGTCAGAGTTAAGAGACAGAGGCACCCCGGACAGAGACGTGAACAACTGAATATCAAAATGACTGAAAAAGCCCCAGAACCACACCTGGAAGAGGATGATGATGAACTGGACGGCAAGCTCAATTACAAGCCTCCACCTCAGAAGTCCCTGAAAGAGCTGCAAGAGATGGACAAAGATGATGAAAGTCTAGCTAAGTACAAGAAAACACTCCTGGGAGATGGTCCTGTGGTAGCAGACCCAACAGCCCCCAATGTCACTGTCACCCGCCTTACCCTGGTATGTGAGAGTGCCCCAGGACCAATCACCATGGACCTCACTGGGGATCTTGAAGCCCTCAAAAAAGAAATTTTTGTGCTAAAAGAAGGTGTTGAATATAGAGTCAAAATTCACTTCAAAGTGAACAGAGATATTGTGTCAGGCCTAAAGTATGTTCAGCACACCTACCGGACTGGGGTGAAAGTGGATAAAGCCACATTTATGGTTGGCAGCTATGGGCCTCGACCAGAGGAGTATGAATTCTTGACTCCAATTGAGGAGGCTCCCAAGGGCATGCTGGCCCGAGGCACCTACCACAACAAGTCCTTCTTCACCGACGATGACAAGCACGACCACCTCACCTGGGAGTGGAATCTGTCCATTAAGAAGGAGTGGACAGAATGAGCACGTCTGCCCCTTACTGTCCCTACCCTTGGCACTTGGAAGAACCCTCTCAGTCATGTTCACTGCACTGTCCCTTCTCCCTGATCACAGCTGGACCCCTTTCCCAACACCCCCACATCGTCTCTCTGATGCATCTTCTCCCACACTCTCTCAAAGTGGTCCCTGGTACTGGATGCTTAAAACCCAAGCTTCAATCCTGCCCACTCCTTCTGACTCCCATCACGGCCAGACCTTCGAAGTTCTCCACCTCAATACACGATCATTTAATATCTCTTATTCCCATTTGAACAGCTAGAGGCCAGGAAATGGGCGAATGATCACTAATTGTTCTTTTGCCTTCGGTTCCAAGGCTCATTCTCACCCCTGGATTCTTCTGTGGTTGCTGCTGGCTCTATGAAGGTCCCTAGTCACATTCCCTGCCAGATGGGTTCTTCTTTTCTGGGAGACACTGTAAACAGCACAAGAGAGTAAGAATAAAACAATCGTATGATCTGACTGAG