Transcript asmbl_108269

Sequence
Transcript Sequence for observation asmbl_108269 of TGE0004776:
AAAGCAAAGAATCAAAATTCTTGAGCTGCAGCAAATGGATTTAGGTTAAACAGCCTGGGGATGGAGGAGCACTAATACCTGAGGAATATGGACCTGTGAAGACCTCTCCAGAATGACAAAGAATCAGAGCTGCGTGTAGGCAGGGGCATGCATTTCCGCATTGCTCAGGGTGCCTCGTCCAGGCTGCTACAGAGGAGTGGCGGGCCCTGGAGACAGGCTAGCGGTGTCGGCGTGAACTAATTCGTTCAAGCCTTGGGCTGCAGAACTGCCCAGAAGAGTGCCGAGAAGGTGGCGCGTAACTTCGGCAGATCCCAGAAGTGCAGCTAGGAAACTTGCCCAGCCAGCCAGGCCCATAGGGTGCTAGAGGGTCAGGAAGGACCCGCCTTTCCTAGACCGTGGCCCAACAGATCCACGTGAGGCTTCCTCGCCACCAAAAGCCCCAAACAAGCAGGGCTAATGAAAGAGGAAAGTTAAGGACGTCCCAAGCTCTGAGACGCGGCGCCCCGCTGCCGGCGCAAGAGCTGCTCTTCCAACAGCTGCGCTTGCAGTCGCCTTGTCCAGCCGAGCGGAGGTCGCTGCCGCTGAGTGATGTCCCGCCGCAGCCTGGACGGGCGCCTCCTCGGGCTGCCCGCGACGTCGGCCCCGCCGCTGCCCCCCAAGTTGCTGCTGTTGCTGCTGCTGTCGGCCGCCGCGGTGCCACCGAGCCTGGCAGAAGTCTTCTATGCAACTGCGTACTGGATGCCTGCTGAAAAGACAGTAAATGTCAAAAATTTACTGGACAAGAATGGGGATGCCTATGGCTTTTATAATAACTCTATGAACACCACAGGCTGGGGGATCCTTGAGATCAAAGCAGGGTATGGTTCTCAGACCCTGAGCAATGACATCATCATGTTTGTGGCTGGATATTTGGAAGGTTACCTCACTGCCCCACACATGTATGACCACTTCATAAATCTCTACCCACAGCTGATTAAGAAACCTTCCATCGTGGATAAAGTGCAGGAGTTTATGAAGAAGCAAGAAGAATGGGCACGTAATAACATCAAATATTATAAGGATGACCCATTTTGGAGACATACTGGCTATGTTATGGCACAAATGGATGGGCTGTATGTAGGAGCGATGAACAGGGCTACATTAATAGGGACAAAGCCTATGACACTGTTCCAGATTCAGTTCCTGAATGCTGTTGGAGATCTGTTGGATCTGATTCCCTCACTTTCTCCCCCAAAAAACTCCAGCCTGAAGGTTTTTAAGAGATGGGACATGGGACACTGCTCTGCTCTTATTAAGGTTCTTCCTGGGTTTGAGAACATCTATTTTGCTCACTCAAGCTGGTACACGTATGCAGCCATGCTCAGGATATATAAACACTGGGACTTCAACATCGTCGATAAAGATACCAGCTGTAGTCGCCTCTCTTTCAGCAGTTACCCAGGATTCTTAGAGTCTCTGGATGACTTTTACATTCTTAGCAGTGGTTTGATATTGCTGCAGACCACAAACAGCGTGTATAATAAAACCCTACTAAAGTTTGTGACACCCCAGTCTCTCCTGGCCTGGCAAAGGGTCCGCGTGGCCAATATGATGGCCAATGGTGGCAGGCAGTGGGCAGAGATCTTTTCAAAATACAATTCTGGCACCTATAACAATCAGTACATGGTCCTGGACCTGAAGAGGGTAAAGCCAAAATATAGCCTTGACACAGAGACTCTGTACATTGTGGAGCAAATTCCTTCATATATAGAATTTTCTGACCAAACCGATGTCCTACGGAAAGGATACTGGCCCTCTTACAACATTCCTTTCCATGAAAAAATCTACAACTGGAGTGGCTATCCAATGTTAGTTCAGAGGCTGGGTTTGGACTACTCATATGATCTGGCTCCACGAGCCAAAATCTTCCGGCGTGACCAAGGGAAAGTGACTGATATGGCATCCATGAAATATATCATGCGATACAACAATTATAAGAACGATCCTTACAGTAGGGGTGATCCGTGCAATACCATCTGCTGCCGTGAGGACCTTAACTCACTTAACCCAAGTCCTGGAGGTTGCTATGATACAAAGGTGGCAGATATTTACCTAGCATCACAGTACACAGCACATGCCATTAGTGGTCCCACAGTACAAGGTGCCCTCCCTGTTTTTCACTGGAACCAGTTCAACAAAACTCTCCATGAGGGCATGCCAGAAGCCTACAACTTTGATTTTGTGACCATGCAACCAATTTTGAAACCTGACAAAAAATGAAGGGGGAATATGAGGGAATAGAAGGCTGCAAATAAGATACCAAAGGCACTATTTTAACTGTTTTTCCATTCAAGATTAGTCTTAATAAAATGTCTTAAATTTA