Transcript asmbl_106833

Sequence
Transcript Sequence for observation asmbl_106833 of TGE0004737:
CTGCAGTTCAGCCTCCTGCTGTTCCTGAGTTAGAGAGAGAAGGCACAAGTTAAAACCACTGAATCAGAACAAGATTTGCCCATCCCAAAGAGGGCAAGTTATTTTCTGCTATCCACCCTAGCTGGAATTTATGCCAGCCTTGGGGGCTTTCTGCTCCCTCCTCCAGTGAGGAAGAGTCTCAGAAGCCCCTCTAATGCAGGTTAAAGAGGTTCAGTCTAGCTAAGGTCAGCTCCCTAGGGCCTCCGCAGTCTGTCTCCTGGGTTAAGAGCTGGCTTTGCAAGAAAAATCTGTGAAGCCTGAGATGCAAGGTTATTAACCCCATTTTCAGCTCTTCATGGCGGGGCTTGGAAGAGGGTGAGGAGAAGGGGTGACGGGGACCGATCTGGGTACCCTCGGCAAATGTTCCGGCGGGCTCCCAGGGAAAAGCCAGTGTCCTCCCCAGCCTAAGGCCGCGGCGACCGAGCCAGGCGAAGGGACCGGGGTACCCCTCACCCTCCAGGAGCTCTAGAGACCCAGGACCATGGACAATTTCAATAGGAACCAGGTAGGCCCTGGATGCAAGACCCAAGTAATGGTGCAGAAAGGACCATTGGACCTGATTGAGACAGGCAAAGGGCTGAAAGTACAAACAGACAAACCCCATCTGGTGAGCCTGGGCAGTGGGCGACTCAGCACAGCTATCACCTTTCTGCCGCTGGAAGAAGGGAGGACAGTGATTGGCTCTGCAGCCAAGGACATCTCACTGCAGGGTCCAGGCCTGGCTCCAGAGCACTGCTACATCGAGAACCTGCGGGGCACCCTCACCCTCTACCCTTGTGGTAATGCCTGTGCTATTGATGGACTCCCTGTTCGACAGCCCACCCGGCTCACTCAGGGCTGTATGTTGTGCCTGGGTCAATCTACCTTCCTCCGCTTTAACCACCCGGCTGAAGCCAAGTGGATGAAAAGCATGATTCCTGCCGGGGGCCGTACTCCTGGGTCTCCGTACAGTCCTGGCCCAGAATCAGAAAGCCTGGTGAATGGGAACCATACCCCACAGCCTGCAACTCGGGGACCCTCTGCCTGTGCCAGCCACAGTTCCCTGGTGAGCTCAATTGAGAAGGACCTGCAAGAAATCATGGATTCACTGGTGCTAGAGGAACCTGGAGCTGCTGGCAAGAAGCCTGCCACAACTTCCCCACTGTCGCCGATGACTAATGGTGGTCGTTACCTGCTGTCCCCCCCAACCAGCCCTGGTGCCATGTCTGTGGGTTCCAGCTATGAGAACACCTCTCCAGCCTTCTCTCCACTCTCCTCACCAGCCAGCAGTGGAAGCTGTGCCAGCCACTCACCCAGTGGGCAGGAGCCAGCATCTTCCACACCCCCACTAGTGCCTGCCCGTTCCTCTAGCTACCATCTGGCCCTGCAGCCCCCACAGTCCCGACCTAGTGGTGCCCGCTCCTCTGAGAGCCCCCGGCTGGGCAGGAAAGGGGTTCATGAGAGGCCTCCCAGCCCTGGCCTCCGGGGTCTGCTGACAGACAGCCCTGCATCTACTGTCTTGGCGGAGGCCCGCAGAACCACTGAGAGCCCCCGGCTATGTGGGCAGCTGCCTCTGGTGGCTATCAATCTGAGTGAATACTCGGCTTCTGGTGCCCACAGTCAACCCACCAGCATTCCTGGCAGTCCCAAGTTCCAGTCTCCAGTCCCTGCTCCCCGAAACAAGATTGGCACACTTCAGGACCGCCCTCCCAGCCCTTTCCGTGAGCTTCCAGGCGCTGAGCGGGTATTGACAACCAGCCCCTCACGCCAGCTGGTGGGCCGAACATTTTCAGATGGTTCAGCTACCCGCACCCTGCAGCCTCCTGAAAGCCCCTGCCTGGGCCGACGGGGCCTGGACAGTATGCGAGAACTCCCTCCCTTGAGCCCGTCTCTGTCCAGACGAGCTCTCTCCCCCATGCCCTCCCGGAATACTCCAGATCCCAAACTAACTAGGGAAGTGGCAGAGAGTCCCCGGCCGCGGCGCTGGGCAGCCCATGGGACTTCACCAGAGGACTTCTCCCTGACACTGGGGTCGCGGGGCCGGAGGACACGGAGCCCCTCACCCACACTCGGGGAGTCCCTGGCACCCAGCAAGGGCAGCTTCAGTGGCAGGCTGAGCCCAGCTTACAGTTTGGGCTCTTTGACTGGGGCTTCGCCCCGTCAGAGCCCCCGTGCCCAGAGGAAACTCTCCAGCGGGGACTTACGGGTGCCTGTCACTCGAGAGAGGAAAAATAGCATCACGGAGATCAGTGACAATGAGGATGACCTCCTGGAGTACCACCGGCGGCAGCGCCAAGAACGGCTTCGGGAGCAGGAGATGGAGAGGCTGGAACGCCAGCGCCTGGAGACCATCCTGAATCTGTGTGCCGAGTACAGCCGGGCTGATGGGGGACCTGAGGCCGGAGAGCTGCTCAGCATTGGGGAGGCCACTGCAGCATTGGCACTGGCAGGCCGGAGGCCCTCACGAGGCCTTTCAGGAACCACTGGGGCCTCTGGGCGGAACAATGAGGAGCCTGGAAGTGCCACCCAACGCCTGTGGGAGAGTGTAGAACGCTCAGATGAGGAAAATCTCAAGGAGGAGTGCAGTAGCACTGAGAGCACCCAGCAGGAGCACGAAGATGCACCTAACACCAAGCTCCAGGGAGAAGTGTTGGCCCTGGAAGATGAACGGGCTCAGGTGCTAGGGCGAGTGGAGCAGCTCAAGGTCCATGTGAAGGAGCTGGAGCAGCAGCTGCAGGAGTCAGCTCGAGAGGCTGAAATGGAGCGGGCGCTGCTGCAGGGGGAGAGGGAGGCAGAGCGGGCACTGTTGCAGAAGGAGCAGAAAGCAGTGGACCAGCTGCAGGAGAAGCTGGTGACTTTGGAGACAGGCATCCAAAAGGAGAGGGACAAGGAGGCAGAGGCCTTGGAGACTGAGACAAAGCTCTTTGAGGACTTGGAGTTCCAGCAGCTGGAGCGAGAGAGCCGCGTGGAGGAGGAGCGCGAGCTGGCGGGCCAGGGGCTGCTCAGAAGCAAGGCCGAGCTATTCCGCAGCATCGCCAAGAGGAAGGAGCGGCTGGCAGTCCTGGACAGTCAGGCTGGGCAGATCCGGGCTCAGGCTGTGCAAGAGTCTGAGCGCCTGGCCCGGGACAAGAATGCCTCCCTGCAGCTGCTGCAGAAGGAGAAAGAGAAACTGACTATGTTGGAAAGAAGGTACCACTCACTCACAGGGGGCAGACCTTTTCCAAAGACCACATCAACCCTCAAAGAGAATGCTCCACTCATCCAGAATGGCACAGGCAGCCTTCCTCGCAACCTGGCAGCCACACTGCAGGACATCGAGACCAAGCGCCAACTGGCCCTGCAGCAGAAGGGGCAGCAGGTGATTGAGGAACAGCGGCGGCGATTGGCTGAGCTGAAGCAGAAAGCAGCAGCCGAGGCTCAGTGCCAGTGGGATGCTCTGCACGGGATGGCCCCCTTCCCAGCAGGCCCCTCGGGCTTCCCCCCACTCGTGCACCACTCCATCCTGCATCACCTGCCAGCTGGGCGGGAACGTGGGGAGGAGGGCGAGCACGCCTATGATACACTGAGCCTGGAGAGCTCTGACAGCATGGAGACCAGCATCTCCACAGGAGGCAACTCCGCCTGTTCCCCCGACAACATGTCCAGTGCAAGCGGCCTGGACGTGGGGAAGATCGAGGAGATGGAGAAGATGCTGAAAGAAGCTCATGCAGAGAAAAGCCGACTCATGGAGTCGAGGGAGCGGGAAATGGAGCTGCGGAGGCAGGCACTGGAGGAGGAGCGGAGAAGGAGGGAGCAGGTGGAACGGAGGCTGCAGAGTGAGAGCTCCAGGAGGCAGCAGCTGGTGGAGAAGGAGGTCAAGATGCGGGAGAAACAGTTTTCTCAGGCACGACCTCTGACCCGCTACCTGCCAAACCGGAAGGAGGACTTTGACTTGAAGACCCACATCGAGTCGTCAGGACATGGCGTCGATACCTGCCTGCACGTGGTGCTCAGCAGCAAGGTCTGCCGTGGCTACTTGGTCAAGATGGGCGGCAAGATTAAATCGTGGAAGAAGCGCTGGTTTGTCTTTGACCGGCTCAAGCGCACCCTTTCCTATTATGTGGACAAGCATGAGACAAAACTGAAGGGGGTCATCTATTTCCAGGCCATTGAGGAGGTATACTATGACCACCTGCGCAGTGCAGCCAAGAGCCCAAACCCAGCCCTCACCTTCTGTGTGAAGACCCATGACCGGCTGTACTACATGGTAGCCCCCTCTGCAGAGGCCATGCGCATCTGGATGGATGTCATTGTCACCGGGGCTGAAGGCTACACTCAGTTCATGAACTGACTGGCATGGGCCTTCTGGACCCTCAGGCCAGCCCCAGGACCCATGCCTGACGATGGCTGCTCTCTTTGGCCCTGGAGACAGAGTCACACCCTGGACTCCAGGCCTCACTGGGGCACTCCCAGAGGACCTGGGAGGGCAGAGTGTGCCTGGGGCTTTTGTACAAGACTTTGTAATGTTGTCTAAGGAGCTCATCCTGGGAGTTTCTGAGCTTGGCCCTCTAAAGAACCAGCCAGGAGATAAAAGGTAGGATGGGGCTTTACTGCCTCCTGGGAGCCCAGAACTTGCAATAACTCTTTAGGGTCCTGCCCTCCCTAGCCTGTATTCTCTTTTGTAAAGAACAAATTATGGTACCTGAATCTGCCAAAGATCCCCTCTTGCCTCAGCCCCCTTTGCAGGGGACTTGAGGGATGAGCAGAGCCACATCCAGAGTGGGGTAATAGCTCAGGCAGTATACTTCTCAAACCCTGCTCTACCCAATTATTCTTCTGCAATTATATTTTTTATTACTTTGCTCAAGGGCCAGAGACCTCAAGTGTCATCCTTGAGGTCTCAGTCCCAACCCTTTTTGCAGACCCATTATCATGGTCACCATAGTAACTGCTTCATTGCCATGGTTACATACTAATTGCTGTGGCTCCATGGCTCAGCCCACTGCTTAAGCTGTGGGCCCATCTGAGGGTATGTGCCATCATCTCTCCAGCCCAAGACCTTGGGTATCTTATGCTGGGGGGAAGGGACTGATCACCTCCCTGCCTCCAGCCTGTGTCTCCAGGCTCTGATACACAGCCTGCTGCCCCAAACCCCCTGCCCTGGGCCAGCCCTCTCCCTTCCACTCGTGCCTTGCTTAGAGCCAGAAGGGATGAAGCTGGGGCTTCTAGATCCAGAGGAGGAGCAATGCGAATGGGAGATAAAGCTATAATGGCTGTCCTCAAGATTTCTGGGGCTGAGTTTCTGACAGGGACAGAGGGCTGCTTCCTTGGGAATGTGAGCAGGAGAGGGAACAGCAGAGAGGGAGGAGTCTGAGGTCCAGCTATGCTCCCTTCGGCCTCAGAAGGGCAATGAAAATGAAGAGCAAAGGTCCAGGCCTCCAGCTGTCCAGCCTCAGCCCTTCAAGCCTTAACATTAGCCCACCTCCCTGTCCCCTTTTCCAGCACTGGGACGTGATAGCTGGGCCCAGCTGAGTGATTTTCAGTATTTGTAAGCATCTCAGCAGAACAATAAAGCATTTGGAGTATG