Transcript asmbl_104409

Sequence
Transcript Sequence for observation asmbl_104409 of TGE0004684:
CGGGGGCAGCGGTGGCGGCGGACGCGGTGCCGGAGGAGAGGAGAATAAGGAAAACGAACGGCCATCCGCCGGATCGAAGGCAAACAAAGAATTCGGGGATAGCCTGAGTTTGGAGATTCTTCAGATTATTAAGGAATCCCAGCAGCAGCATGGCTTACGGCATGGAGATTTTCAGAGGTACAGGGGCTACTGTTCCCGCAGACAGAGACGGCTCCGGAAAACGCTTAACTTTAAGATGGGGAACAGACACAAATTCACAGGGAAAAAAGTAACCGAAGATCTTCTGACCGATAACAGATATTTGCTTCTGGTTCTGATGGATGCTGAAAGAGCCTGGAGCTATGCCATGCAGCTCAAACAGGAAGCCAACACTGAACCCCGAAAACGGTTCCACCTGTTGTCTCGCCTGCGGAAAGCTGTGAAGCATGCCGAGGAATTGGAACGCTTATGCGAGAGCAATCGCGTGGACGCCAAGACCAAGCTAGAGGCTCAGGCTTACACAGCTTACAAAAAAAAAAGAACATCAAGAGTGGAAAGCTGCCATTGAGGCTTTTAATAAATGCAAAACGATCTACGAGAAGCTCGCCAGTGCTTTTACAGAAGAGCAGGCCGTGCTGTACAGCCAGCGTGTGGAGGAGATCTCGCCCAACATCCGCTACTGCGCGTATAACATTGGGGACCAGTCAGCCATCAATGAACTCATGCAGATGAGATTGAGGTCTGGGGGCACCGAGGGTCTCCTGGCTGAAAAATTGGAGGCATTGATCACTCAGACTCGAGCCAAACAGGCAGCGACCATGAGCGAAGTGGAGTGGAGAGGGAGAGCGGTCCCGGTGAAGATCGACAGAGTGCGGATCTTTTTGTTGGGGTTGGCCGATAACGAAGCAGCCATTGCCCAGGCTGAGAGCGAAGAAACCAAGGAACGTCTGTTTGAGTCTGTGCTCAGCGAGTGTCGGGACGCCATCCAGGCCGTGCGGGAGGAGCTCAAGCCCGATCAGAAGCAGAGAGATTACACCCTCGAGGGAGAGTCGGGGAAGGTGTCTAATCTTCAGTACCTGCACAGCTACCTGACCTACATCAAGCTGTCAACGGCGATCAGGCGGAACGAGAACATGGCCAAAGGTCTGCAGAGGGCCCTTCTGCAGCAGCAGCCGGAAGACGACAGCAAACGCTCCCCCCGGCCGCAGGACCTCATCCGGCTCTACGACATCATCCTGCAGAATCTGGTGGAATTGCTCCAGCTTCCTGGCTTAGAGGAGGACAGAGCCTTCCAGAAAGAGATAGGCCTCAAGACCCTGGTGTTCAAGGCTTACAGGTGTTTTTTCATTGCTCAGTCCTACGTGTTGGTGAAGAAGTGGAGCGAAGCCCTCGTCCTGTATGACAGAGTCCTAAAATATGCAAATGAAGTGAATTCTGATGCTGGGGCCTTCAAGAATAGCCTGAAAGACCTGCCTGACGTGCAAGAGCTTATCACGCAAGTGAGGTCAGAAAAGTGCTCTCTGCAGGCGGCGGCGATCCTGGATGCAAGTGACTCCCACCAAACAGAGACTTCCTCTCAAGTCAAGGAGAATAAGCCCCTGGTTGAGCGGTTTGAGACCTTCTGCCTGGACCCTTCCCTCGTCACTAAGCAGGCCAACCTCGTGCACTTCCCTCCGGGATTCCAGCCCATCCCTTGCAAGCCTTTGTTCTTTGACCTGGCGCTCAACCACGTGGCTTTCCCACCCCTCGAGGACAAGTTGGAGCAGAAGACCAAGAGTGGGCTCACCGGGTACATCAAGGGCATCTTTGGATTCAGGAGCTAACCACTCTTTTCCTTGGGGGCAGGGGGTAATTCTGACTCGGTCTGTATTGTGAGAAAACTCTAGCAAGTCTGTGATATTAAATCCAGGTCTGCGTTGGCCCAGGGCGGGAGTGTAACATCCTCAGCCCTGCGTTCCTATGTCTGTGTGTGTGCGCTCATGTTCTTAACCGGTGTGCCAGGAGGGCACCCTGTTGTCTTCTGGTGGATGTGTGCGGGGTCCCTCTGTCCATACCTCCCGGAGGAGGGCCGCTGCCATCTGGGCCCGTGCGAGCTGTGATTGTTTACCTCTGGTCCGTAACGTGTTCGGGAGGAGGTCCACTCCAGGCACCGCGAGCGCTCGGAAAGCTTTGCTGCGTTTCTTCAGTGCTGTGGACTTAAAACACACTCCTCCTCGCTGTGAGCATCCAGGACCCTTTGGAAAGTTTGTTCGTGACTAGGAAACACTGGCAACGTCCCCCCAGAACGACAGTCAGCCTCCCCCCTTCACTGCCAAGTGAAAGTTCAGAAGTTTCAGAACAAGCAAAGAGCTCTATTTTTAGAAGAAATATGTTATACTCAGAATTGATGAAAACAAATCTTATATTAAAAGGCAAAGATGCTGGAGACTGTGCCCATTTTTTACACGTCCTCACTCAACATCGGTCCCAGTTCTCTCCTCAGGGACGTCGTTGCACAATCCTGTCATGTCTGGTGCGTCCCGACTTCCTGGCACCGTGGGTCTGTCTGATGCCAGATAAGATTGTGTTAGAGGCTCTGTTTCTATAGAGGCCTCAGTCTGTAAGTTTTAGATGCCATTTCATGTTAATTAGTCTCCTTGCCTACCTCTACCCCTCTATTTTTTCCTTAGTCACCCTTTCTTAATTTCTATTGTAGCATCAATAATAAGTCACAAAGCAATGTAAGGAAGCAAGGAATAAAAGTGACTTAACAGGAGATGGACCCGAAACCTCTGAATCCCTTTGGAAGTGGAAACTCATCCCACAGGAAAGAGATTCCTCCACGGGAAGTGCTGGCCGAGGTGTAGCCCGGGCGTGGAGCCGACTAGAGCAGCATGAAGAGGAGGTGGGCCGGTTAAGGATCTGAGAACATTATCTCAAGATGGGTCCCCATTGCGGGCACCATGGTGCCTCTTGCCTGACTAGTGAATTGCAGGAAGGGATTGCCTGGAGTTAGACGAGGCGGGAGACAGAACAGACTTCGTTAGAGCCGAATGTCCTCAAGCACTTAGCTGCTGCTCAGAGATGTGACCTCTCCTCCCCCAGGTTTTGCTTTGGGTCAGAGTCTCAGAAAGTGAAATTTTTTTAAATCGAAAATGTCATAGTCTCTGCCACATGATTTGGGGTATCCTTCCCCCTCCTAAAATATCACGCAGGTGATCTTAGGCTGAGGTGTTGGGTTTTGGTCCCAAAGGCTCAAGGCGGTGTCCCTAACGTGCTGAGTGTCGGAGGCTTCCCCGGCTCACTGGTGCCCCTGGCAGTCCCAAGGCTGCATGCAGTCCAGGTTTGGCAGCTCCCTTGCCGCCTCCTGCTGACATTGGCCACAGCCACAGCTGGACTGTCCTGCGCCAAGAACCCAGGTCAAGGCCCCACTGTGCAGGCAATGCCCAGCCTCCCTGTGCCGGTGTGGGGCTCTG