Transcript asmbl_104387

Sequence
Transcript Sequence for observation asmbl_104387 of TGE0004678:
GTTATCATAGAGACGCAGGGCTAGATCGTCGGCCTCCTCGGAGGCAGACATTTTGGATCCTGGCAGAAAATTGGAAAGGGCTGGAACCACTAACGAGTCAGGACGTACCTCCCGAGGACGTGACAGCAAACGAGATCCTGTGTGGATGACACAGTCAAGAGGTAGAGAGAACTGTGACGCTTCCCTAGGAATATCAGGCTTTTAGAGCGTTGCCCACCGCCCTGCCCTCATCTGAGATGGCGGCTTTGCGGCCGCTCTAGCCCGCGCCTCTCGGATGCCCGGAGCCCCGGAGGGGGCGGCGGCCTCGCCACTGGCCCTCGGGAGGCTGCGGCACGGCTCGCCCTGAGCTCCGGGTCCCACAGAGCGCGTCGCGGCCTTTCGTACGAGGAGGCTGGGCATCTTGGACCGCTCCCCTCCTCTGCCGGGTTCCTTGGCATCTTCTCCGGCCGGACCCCCGGGCCTCGCGGCCCCCTCAGTCGGCACCGTTCCCGGCTGCAGCCCCGCGCGGGCCGGCTGTAACCGCGCCGCGGGCCGGACGATGCCCAGGAAGCTGCTGCTGCTGCCCCCGCGCTCCGTGCCCTCGGCTTTCCGCGCCCCGCGAGCCAGCTCCTCCGCAAGCGCGGCCATGAACGCCGCCCGCACCGGCTACCGAGTCTTCTCGGCCAACTCCACGGCCGCCTGCACCGAGCTGGCCAAGCGCATCACCGAGCGTCTTGGTGCTGAATTGGGGAAGTCTGTGGTATATCAAGAGACCAATGGAGAAACAAGAGTTGAAATAAAAGAATCTGTTCGTGGCCAAGATATTTTCATTATACAGACAATACCCAGAGATGTGAATACAGCTGTGATGGAGTTGCTGATCATGGCTTATGCGCTGAAGACGGCCTGTGCCAGGAATATTATCGGAGTCATCCCTTATTTCCCCTACAGCAAGCAAAGCAAGATGAGGAAGAGGGGTTCCATCGTGTGCAAGCTACTAGCATCCATGCTGGCGAAAGCAGGTTTAACTCACATTATCACTATGGACCTTCATCAAAAGGAAATACAAGGCTTTTTCAGCTTTCCCGTGGACAACCTTAGAGCCTCACCTTTCCTGCTTCAGTATATCCAGGAAGAAATTCCAAATTACAGAAATGCAGTCATCGTAGCGAAGTCTCCTGATGCTGCAAAAAGGGCCCAGTCATACGCTGAGAGGCTCCGTCTGGGTCTAGCCGTGATCCACGGAGAAGCACAGTGCACAGAGCTGGATATGGACGACGGTCGTCACTCACCTCCGATGGTCAGAAATGCCACCGTCCACCCGGGCCTGGAATTGCCGTTGATGATGGCCAAAGAGAAGCCACCGATAACTGTCGTCGGAGACGTCGGAGGGAGCATCGCGATCATAGTGGATGACATCATCGACGACGTGGAAAGTTTTGTCGCTGCGGCAGAGATCCTGAAGGAGAGGGGCGCTTACAAGATCTACGTCATGGCCACTCACGGCATCCTGTCCGCAGAGGCCCCCCGCCTCATCGAGGAGTCCTCCATCGATGAGGTGGTGGTGACGAATACTGTCCCTCACGAGGTGCAGAAGCTGCAGTGTCCCAAGATAAAGACTGTGGACATCAGCCTGATTCTCTCTGAGGCCATTCGGAGAATCCACAACGGAGAGTCCATGGCGTACCTCTTCCGGAACATCACTGTGGACGACTAGCTTTCTCTGGAACTCCTGAGACGCGTGGGAGGCGGCAGCAGTGTGACGTCCGCAGCGTTTCCTTGCAGGGGACTCGGGTGGTCTCGTGCCGTTCGCTTTGTAGGAGGCTTTAAGATAGTCGAGGGGGAGACACAGCTAATGGGTAAAGGGCCTTAAACGTCTGCCCTCACCATCCCGTCCCTCAAACAGAAGTCACATTTTCCTGAAAAGAACCTGAACATCTTCTGACACTGCAAAGGCGTTAGAGGCAGAGACAGTGCTAACTCTGGTGTCCGTTCAGCTGTTTCGGCCGCAGGGAGACGTGTGTTCACGTTGAACTTGGGCGGGCAGCTGGGCGCCCCGGCTCTGTGCCTGCTGCAGTTGTCCTCTCCCTGGCCAACTGCACGTAAACCTTTTGTAGAGAACCGTGTTTTCCTCTGAGAAGCTGCTGTGCGTACAGCCTCTGAACCATAAAGCATTTAGCGTCATCCCCAGCAAGGCCCTAGATAGAGAATAAGACCCTGTCTCTCGGTGTCTGCATTGCTCTTAAATTACAAATAAAGGAATTTGTTATCTTGCTCGTCTGGTCACTCCATTGCAGAGCCGCCCACTGCCCCGCCTCAGGGTGACTAACTGCTGCCGAGTCTGCAGAAGGCAATGGATGTAAAATAAAGGCTGGTTTAGGTCCATGGCTGGTCCCAAACCCTGGATGTAAGTCTCCTTCTGCAGGTTCCGTCCCCTTCCTGAGCACCGAAGTTAAATCCTTGTTTAACGTGTTTAAGATCTAAATTTGTAAAAAACAGGACTACTTGTACTGGTTCCTGTTGTAGGTAACGCGTTTTCTATATTACTTAGGACTGTACTTGGCCTTTCTACCCAGCGTTTAAAATTACGTAGTCACAATTCTAATTTATTCCCCATTTGTCAGGTGGGCCTTGCTGCAAATATGGTCTAAACGTTTTGTACCTTCAGCCTCAAGCCAGGGCTAAATGTAACAGGAAGGAGGAGTGTCCGCTATGAAAATGAACTGGAGTTGTTTATTGGTCCTGTTAGTTCCTGAGAAGTAATAAAGGACCATCCGCTTATTTGTGCAATTGTATTTCTCTGCAGGGAAGTTTCCTGGACATTTTTATCCCCTTCCTAACAACTAGAAACGTTCCCAACCCACAGTCAGGACTCTGAGCACATTAGCTTTCGAAGCATACAAACCAGTAGCTAATAGTCTAA