Transcript asmbl_104320

Sequence
Transcript Sequence for observation asmbl_104320 of TGE0070978:
TAGGCATCGACGAAGGGCAGTTTGTGAGTTGGTTTGTCCTGGCGTCGTTCTTCCCATGAGCTCCCCTCACTGTCCCCCTATCTCATCTTTATTCTGTTCTCTGGGTCAAGCTGGGTAGCAAATGGTAGGGGGGCCGTCATTTTTCCTTTGCTTTGGGAAAGCCTCGGCACTCCTGGCCGCACCGGAGGGCCGCTGTCGTACTGCTGGTCCCGCCCGCCCAGGTCAGCGGTCCCTTCTGTCTCGGAACAGCGTGTCCCGAGAGGTTTCATTTAAGTTTATCCCGTGTGTGTTTGGTGTGGCTTCTAGATGCGAGCGCTCGTGCCTTCCTTTCTGGCAGGGAGAAGGAAGCCCTTGTCACCCCACCTCTCTCGCGAGGGGTCCCGATGCGTGCTTGGTTTCGATGACTCTGGTGTTCGTTTCTGGGGTTTCCAGCTAGTTCTCTCTGCATCTCCTCTGATCCGATCCGCGTCGCCCGGTTTGCACTCGACGGTTCACCGCCCTCCCGCTGTCATTCCGAGATCTCGTTTCACAGTCTTTCCAGCTCACTGTTTCCAGCTCTGCAGACCAGGCGGGCCGTTTCTGTGGCCTCCGTTTCTCTCCTGTGCTTCGTGCTTCGGAACTTTTTGTTTCTGCCAAGTGACTCTGAATGGATGAAACAGCCCCTGCCCCGCCCCGCGCCGTGGAGGTGGGTCCGCGAAGCTGCTACAGACCCCTGGTCCCAGCAGCTGAACGGGACAGGCGCTTATTCCAAGGCGGCGGGGGGAGGCCTGCCGACGAGGTCCCCGTCCGCACGCGTGGCTTCTGAGGCGGTCCTGCATGGCCGCATCCAGTGGCGGAAATGGGAAACCGGGGCGGGTCGCCTCGTGTGGGGATTTTGTGAGCCGGGCTAGAAGTGTATTGGCTGCAGTTAGTCTAGCTCTGCCCTGGAGGAAGAGGAAATTGGAAGTTAGAGAATTTTTTTTGTTTATTCGGTTAGCGGTCTCTGCCCACCCCGCCTCCTAGGTTCCCAGGGCAGAACCAGGTGCTGGGTTTGTAACGTCCTACAGGGTGTTCTGTCACAGCCACATGCTGTGTTCTCACGTGGCGAGGCTGGCGGGTCTCCCACCCCCCAGGGGCGGACCCTTTGGGGTCCCAGACATGCCTTCCTGGAGTCGGAACGCCTGTGCTTCGTGACTGTGGGCGAGGCGCTCATGTTGCTTTGCGGATGTCATTGGCATCTGGGGAGACGGCCCCTGAAGACCCCAGATGCAAGCCGAGGGTGCTGGCGTGTGAGCCTCGCAGCGGTCACCCCCGCCTGTGGCTTAATGGCTAGGCGGTAGTGGAAGTCGTGATTTAAAAACCTTTTTATGTCTTATCTGTTTTACTACACAAATAGTAACATGTGTGACCTAGAAGTTAAGACTACGCACGAAAGTCCGTAGGTGACCACTGTCCACGTCCTCTAGCCCGAGACCACCAAGAACGGCCCCAGAGCCAACCAGGTTCCGGTCTGAACACACCGTGGGACCCAGGGGTGTCCCGTGAGGGGCTGGGGAGGACTTAGTGTTAGGATTGGGGCCTGTGTGGGGTCATTCTTGGGGGGGCTTTAAGGGGCTGGTTTACCTCGATTCAGTGCCCTCGGGAAGGGAAGTGGTCTTTGGCCTTTTCGCTAGGGAGAGTGGGTCAGGAGGACACTAGCCCCGCACTTCTGGTGGCCGGGGGAGCGGGGGTTGGTCCTTCGTTCACGGTCTGTCTCTGTCTCTGCTCAGACATGTGACCGGGGAGTGGTCTTGTTTTTGTCTTGACCACTCACAGTCACAGAGCGGCCTTGTGTATTCAGCGGGACAGCACCGAGGCCGGGCTGTGGGTGCCCGGCCAGCTCCTTCCTGTCACCGGAGCGACTTTTCCCTGCCCAGAACAACAGACAACACGTAACGCGATCGGTGTCCTTCTAGTCTTTACGGACTCGTGTTTGGCTATAGATTGGGCTTGTGTCACACGATGTGGCCATTTGTCCACATCAGCAAACGCCCGCCCTTACGCATGTGCCACCTCCTCCTTCAGCTGACCCCGTGCAGCATTCGAAGGCAGTGACGGACATCTCGGGCTGCCGCCCGGTGTGCTGGGACTCCTACTAAGTGGGGTGCTGGTCAGCCGGCCAGTCTCGTTCTCTCGGTATTTTCCGAGCTGGTGCCACATGGTGGCGATGTCCTAGGTGTCAGGGATACAGCCAGAGCCTCCGCCCTTGCGCTTACGCTCCCGTTAGCGAGGAGAAGCGTGTCATAGGTGACGGCTGGAGGAGGAAGGCCGCGTGGGGGGGACAGACCCACAGTGGGGGTGACGCTTTCCGGGGCTGCCTGAGGAGAGTGGGCGGCAGGGGTGAAGCCCGAGGCTGGCCTGTGCCGGGCTGGGCGTCTCAGGACAATAAAGGCGGCCAGTCGGCTTTGGGTGGGGAGTTAACCCCAGGAGAGCCTGGAAGCCGCTGGAGGGAGGCGCCATCTGAGCTGGGCGAAGGCACGGAGGGCTGGGAGGGTGGCCGGCGGGGGGCGGAGGAAGGCGGTGGGACAGCTTGGCCTCTGCAGAAACCCCCGGGAGAGTCGGGTGGCGGGGCGGGCGGCAGGGGGCAGGGGCCACGGGCACACACATCCTGCGCTCACTGCGTTTCTCGTTCGTCGCTACTCTGGCTGACATCTTTTCCCGTGTTTGTTAGCCGCTCGCATCCATTTCTCCTTCCGTAAGTCGCTCTTTTTACTGCTTGCACCCACCTTCTCCTTGGTTTGTCCTTTATCTGACCGACGGGGCCACTTGGCCACGTGCTGCAAATATCTGTCCCCTGTTCTTTTGCCTTTGAGTTTTGTCTGGCGTTTCATCGAGTCTGTTACCACTCCTGCTCGAGTGATTTTCTCCGTCGCGTCCTTCCTTCCGGTCCTTGGTGGACGCGTGCCGTCTGCACCGGCATGTGTGCCCAGAAGCGGAGCCCACGTCCTTCGCTGCACGTCCTGAGCCAGCCAGCTCTTGGCAAGGTGATGATGGAGGCGGAGGCCGACCTGGAGGCCTCTAACCTCTCCTCATCTACCAAGAAAGCCCGGAATCCACTAGGGACTTCAAAGTTCCATTTGAAATGTCAGCCGTTTTAAGGTGGGCAGGTGCAGGCCAAGGCCGTGACTGAGGACCAGGTACAGGCCTCTGTCCTTGGCTTGTAGATGCCGACGGCTCTGTGTCTTCACATCTTCCCTGTGTGTGTCTCTGTCTAAATGTCCCATCTTATAAGGACCCCAGTCACTGGATTGGGACCCACCTTACGGGCCTCGCTTCAGCTGAATGACCTCTGCAAAGACCCTATCTCCATATGTCACATTCTGAGATATTGGGGGTTAAGGTTTCAACATGAATTTGGGGGGTGGGAGGGGACACAGTTCAACCCGTAACACAGCCTGAAAAACTAACGTGGTTACCAGTGGACGTTTGGGAATGCTACAGGGACCTGGGTGGCTCTGTCCTTATCCCTGATGGCGGCTTAGAGAAAGGCCCTTTGCCCAAAGTCACTTCAGTCAACCCAGAGACCAACATCTAGAAGGCAATATGACTGACCAATAAACATGCACCAAATGGTTCATTTGAGTAGCACCCTTGCCCTGGGCCACGTAAAATGAAGGTCGGTTTACCGAGTAGTGACCGCAGAGGGCCGTGTCTGGAAGGGCGTGCCGTCATCCTGGCAGCGCACTTTATGCTAAACAGTAAGACGGCGAAGCCCCCCCGCCTATCAGCCGAGTGGCGTGTGTAATAAACTCAGTGCCTTTAATCCTCAAGCAACACCGAGGCCTTTCTGGCCACTTAGGCTCAAGAACAGGAAGTCATTGCCAGGGCCACACAGCTGATGGGTTCCAGCCCCAGGCAGCCCTCTGGCCTGAGCACCCATGACTGTGGTGGGGGGTGAGTGCAGAAACACTGGTCTCCAGCTGGGGGGCTGGCGGGGAGGGTTAGGGTCCCTGTTTGTGCTCTAGGCCGATCCGGGTGGCTGGAGTTCCCTGCCCGGCAGCATCTCGGTGGCTCCTGGGAGCTGCTGCTCAGGGCGGACGCTCTTTCCGCTCACCTTTCCCAGTTCCCTGACATTGTGGAGTTCAGCGAGGCCATGGCCAACGCCGGGAAGACTGTGATTGTGGCTGCACTGGATGGAACCTTCCAGAGGAAGGCTTTCGGGACCATCCTGAACCTGGTGCCCCTGGCCGAGAGCGTGGTGAAGCTGACGGCCGTGTGCATGGAGTGCTTCCGCGAAGCCGCCTACACCAAGAGGCTGGGCATGGAGAAGGAGGTTGAGGTGATCGGAGGAGCTGACAAATACCACGCTGTGTGCCGCCTCTGCTACTTCCGAAAGGCCTCGGGTCAGCCCGACGGGCTGGACAGCAACGAGGACAAGGAGAACTGGCTGGTGCTGGGAAAGCTGGGGGAGGCCGCGGAGGCCAGGGCGGCCACGGGGGCCCGGAAGCCCCTCGCTGCGCATCAGATCCTGCAGCGCAGCCCCCCCAACTGAGGCCCCAGTGATGCCTTCCCCTCTGCATGCCCGGCGGCCTGTCAGAGGAGGAAGTCCCAGGTGGGTGAGGCTTCCTGGGCACCTGGAACTTTCTGCCATCACAGGGCCCTGCCCTGCTGGCGGTATGCGGCCCATTTCTCCCTCTGCCTGCCCACTGCCTCTCAGTTCCCTTCCCAGCTGCCGATCCGCTCAGGACCACCCCGGGCTGGAGCCGGCCACTGCCCGCACCGCTCCTTCTCCTTTGAGCTGTGGGGCAGGCCACACGCTGCTGTGACGTCAGCCCGGCTGGCTTCTTCCCCCTCTGTGGCTTTCACTGTTGAGTTTCGGTTCTCACTGGGAAGTTCAGGCGGCAGCACCTCTGGCTCAGCGCGGAGCCTCATTCCACACAAAGGATTCTGTCCCTTGGCCTGGGACAGGCTCCCAGCCGGAGGGCGGCTAGACTTGTGCCCTTTCGCTTCCCTGTGGGCTGAAAGCTCTTCCTGCTCTGGTGATGACTTTCTTGAGGCTCACAGCTTCATTCATGTGGGTGACACCTGCTGAGGCTCAGACCCCAGGGGTTTGCTAGTCTTTTATGGGGAACTGGGGGCAAGGTCCCTGATTCTTGTGGTAGAGAGTGAAATGAATACGTGACATTAAAATGCACTAGTTGGCAGGAGCGTATTTCTCTCTAAGCGCCTGGAATCCCCGGGCCACACCGCAGGCACCGACGTGACTCGGTGGGGACGTGACTCGGTGGGGACGTCTTCCTGGATCCTTGTTTACACCACTG