Transcript asmbl_104267

Sequence
Transcript Sequence for observation asmbl_104267 of TGE0004671:
CGCACGCACGCACGCACGCACGCGCACGCGGTGGCGTCAGTTCCCGTCGGCGGCGGCGGCGCCGGGCCCCGCTTCCGCCTTCCGCTGAGGCGCGCGCTTTGCTCTCATCCTGTTCGGGATCATGGCGGCCACGGCCACGATGGCGACCTCTGGCTCGGCGCGGAAGCGTCTGCTCAAAGAGGAAGACATGACCAAAGTGGAATTCGAGACCAGCGAGGAGGTGGACGTGACCCCCACGTTCGACACCATGGGCCTGCGGGAGGACCTGCTACGCGGCATCTACGCCTACGGATTTGAAAAACCGTCGGCAATCCAACAGCGAGCCATCAAGCAGATAATTAAAGGGCGAGATGTCATCGCACAGTCTCAGTCTGGCACAGGCAAAACTGCCACCTTCAGTATTTCCGTCCTCCAGTGTTTGGATATTCAGGTTCGTGAGACCCAGGCTTTGATTTTGGCCCCAACGAGAGAGCTGGCTGTGCAGATCCAGAAGGGCCTGCTCGCTCTGGGTGACTACATGAACGTCCAGTGTCACGCCTGCATCGGGGGCACCAACGTGGGGGAGGACATCAGGAAGCTGGACTATGGACAGCACGTGGTCGCCGGCACGCCGGGCCGTGTCTTTGATATGATTCGTCGCAGAAGTTTAAGGACACGTGCTATCAAGATGCTGGTTTTGGATGAGGCCGATGAAATGCTGAATAAAGGTTTCAAAGAGCAGATCTACGACGTGTACAGGTACCTGCCCCCGGCCACGCAGGTGGTGCTCATCAGCGCCACGCTGCCCCACGAGATCCTGGAGATGACCAACAAGTTCATGACCGACCCCATCCGCATCCTGGTGAAACGTGACGAGCTGACTCTAGAAGGCATCAAGCAGTTTTTTGTGGCGGTGGAGAGAGAAGAGTGGAAATTTGACACTTTGTGCGACCTCTACGACACGCTGACCATCACACAGGCTGTCATCTTCTGCAACACCAAAAGGAAGGTTGACTGGCTGACAGAGAAGATGAGAGAAGCCAACTTCACCGTGTCGTCGATGCATGGGGACATGCCACAGAAGGAGCGGGAGTCCATCATGAAGGAGTTCCGGTCTGGTGCCAGCCGCGTGCTCATTTCCACCGACGTCTGGGCCCGGGGGCTGGACGTCCCTCAGGTGTCCCTCATCATCAACTATGACCTGCCCAACAACAGAGAGCTGTACATCCACAGGATCGGCCGGTCGGGCCGGTACGGCCGGAAGGGCGTGGCCATCAACTTCGTAAAGAACGATGACATCCGCATCCTGCGGGACATCGAGCAGTACTACTCCACGCAGATCGACGAGATGCCCATGAACGTTGCCGACCTGATCTGAGGCGCCCGCCGGGGTCCCGCAGCCACGGGGGCCGTTCCGGGCCGGTCCTCGTTCCTGGAGTCATGTGGACTCTCCTCACAGAGTCCCCGCAGTTGGAGTCATGTGGATTCTCCTCACAGAGTGCTGGTGGTGGTAGAGGTTCTTCCTTTTCTTACTTATGTGTAAATAGCGCTTTGCTTTATGTGTTTTTCATTAAACGCTTGAAACTCTTCCGTTG