Transcript asmbl_104161

Sequence
Transcript Sequence for observation asmbl_104161 of TGE0004667:
ATCATTCGTGTTCAGTCCCCGGATGGGGTGAAGCGGATCACGGCAACAAAGAGAGAGACAGCTGCGACGTTCCTGAAGAAGGTCGCAAAGGAGTTTGGCTTCCAGAATAATGGCTTCTCAGTTTACATCAATAGAAACAAGACCGGAGAGATAACAGCATCGTCCAACAAATCCCTCAACCTGCTAAAGATCAAGCATGGCGACTTGTTGTTCCTATTTCCCTCGAGCCTTGCCGGACCGTCATCTGAGATGGAGACGTCCACCCCGCCGGGCTTGAAGGCCCTGGGCGCGCCCACCGTGGTGGAAGATGAGATCGACCAGTACCTCAGCAGGCAGGACGGCAAGATCTACAGGAGCCGCGACCCGCAGCTATGCCGACACGGCCCTTTGGGGAAGTGCGTGCACTGCGTCCCTCTAGAGCCATTCGATGAGGACTACCTAAACCATCTCGAACCGCCCGTGAAGCACATGTCCTTCCACGCCTACATCCGAAAGCTGACCGGAGGGGCTGACAAGGGGAAGTTTGTCGCCCTTGAGAACATCAGTTGCAAGATTAAATCAGGGTGCGAGGGACACCTTCCGTGGCCTAATGGCATCTGTACTAAGTGCCAGCCGAGTGCCATCACGCTGAACAGACAGAAGTACCGACACGTGGACAACATCATGTTTGAGAACCACACGGTCGCTGACCGCTTCCTCGACTTCTGGCGGAGGACGGGGAGCCAGCATCTCGGGTACTTGTACGGGCGCTACACGGAGCACAAGGACATCCCTCTCGGCGTCAGGGCCGAGGTGGCGGCCATTTATGAGCCTCCTCAGATTGGTACACAGAACAGCTTGGAGCTCCTTGAAGACCCAAAAGCCGAGGTGGTGGATGAGATCGCTGCCAAACTTGGCCTGAGGAAGGTTGGCTGGATATTTACGGACCTTGTCTCAGAGGACACCCGAAAGGGCACAGTCCGATACAGCCGGAATAAGGACACCTATTTCTTGAGTGCAGAAGAATGTATCACTGCAGGAGACTTCCAAAATAAGCACCCCAACATATGTCGGCTCTCTCCAGACGGACACTTTGGATCCAAGTTCGTTACTGCTGTGGCTACAGGTGGCCCCGACAACCAGGTCCACTTTGAAGGGTACCAGGTGTCCAATCAGTGCATGGCGCTGGTCCGTGACGAGTGCCTGCTGCCGTGCAAGGACGCCCCTGAGCTCGGCTACGTCAAGGAGTCCAGCAGTGAGCAGTACGTGCCCGATGTGTTTTATAAGGACCTAGACAAGTTCGGCAACGAGATCACCCAGCTGGCCCGGCCCCTGCCCGTGGAGTACCTGATCATAGATATCACAACAACTTTCCCCAAGGATCCAGTTTATACTTTTTCTATTTCGCAAAATCCGTTTCCTATTGAAAACCGGGATGTGCTGGGTGAGACACAGGACTTCCACAGTTTGGCCACCTACTTGTCCCAGAGTACCTCAGCTGTATTTTTGGATACCATCTCGGATTTCCACCTCCTGCTGTTTCTGGTCACCAATGAAGTCATGCCTCTGCAGGACAGCATCAGCTTGCTGCTGGAGGCCGTGAGGACCAGGAACGAGGAGCTGGCGCAGACCTGGAAGAAGTCTGAGCAGTGGGCCACCATTGAGCAGCTCTGCAGCACAGTCGGAGTGCAGCTTCCGGGCCTCCAGGAGTACGGTGCCGTTGGGGGCCCCTCGCACGCCGCCGCGGCCGCCATGTGGGCCTGTCAGCACTGCACCTTCATGAACCAGCCGGGCACTGGCCACTGTGAGATGTGCAGCCTCCCCAGGACCTAGGGCTTCTGCCCCTGTGGCGGGGCCGGGCCCCTAGCCCTCCCTGAAGCCAGGACCTTTGTGACCGTGCCCCTTGGGCAGCCCTGAGGGGCGAGGCAAGGTAGCTGCCCCCCGGGTTCCTGATCCACAAGGCTTCTCAGCATCAGGCTTCCCTGGAGGAGGGCCCGGCTGGTGCTCTGCCAGCTGCTGGCAGCCACCTCGGGCAGGCGCAGCCCAGACACCTCTGGTGTCAGCCCCACCGTGGTGGAGGGACTGGCACCCCATCTTCACCCGGAGCGGAGGGGCGGGGCGCTCGCTGCTGCCTTGGCCTCCTTTCTCCTTCTGGATGCTTTCTGTTCTTGCCTCCCCCTGGTTTGGTGGGGGTCCCCCTTGGCCTCTCCATCCTGCTGCTCTGGGGCAGACCCTACCCTGAGGCCACTTCCTCCCTTCCCGGAGCCATCATCCGGTGGAAGTGCGAGTGGCCTCCGGCTCGCTGGCCTCCCTCTGCTTGATCTGCAGGTTGATTTGCTGCCCACCCTCTCTCCTGCTCCCGCCTGCCGTTCAGGTGGGATTTTAAAGTCGGCATTGGTTGTAATAACAGTTATTAGTAATTTCTGCCCAGAAGACTTTTATTTATTTTTTTTAAGATAAAAAATGCATAAAAGGGGAGTGAGAGAGACTAGTTTCCTCTTCCTTCTCTCCTCTAGTGAGTCCCCGTGGGTGTGTGCAGGGCGGGTGAGTGTGGCAGGGGACTCACAGTCAGTTCTCCATGGAAGCTAACCTCAGTGCCTGAGACTTTTCTGCCAAGCCACACAGCTGCAGGTACGGGCCGACCCAGCAGGAGTGGCGCGGTGGCTCCACCAGGCAGGTGGCTCCACCAGGCAGATGGCCCCTGCAGACGGCTGATGCCCCTGACCAGGCCCACATGGGGTGAGCCGAGTTAGCCAAGGTCAGAGCTCGGGTTCCCTTTGCCCCACACAGTCCCATAGCCCTGCCTGGCCCCTGGTCTCTGGCACAGTGACGTGGCCATCAAGAAAAGGAGCAGGGGCTTGACCTGTCGTGAGCGCACATGGGTCGGCTGTGGGGGCATCGGCAAGTTGCTGCTGTGCTGATGGAGTGAGGTCCGCACCCTCCCAGGACAGAGATCTGGGCAGACCTCGCACATGTGCCCTGTGGTCCCGCATTCTCTCCACGGCTGGGGTGTGTTCAGGCCCTTCCCCAGGGACTCGTGGGCATGCTGATGCCTCTTTGCCTTAACAAGAGCCGTATCTCTGAGCTGCCCCGCACCCATGGGAGAGGCCAACCAAACAGACTGCTTGGGGACTTCGGGTCTGCCCTGGGTTGGGGGCCAGCCTGTGGGACCCTCCCTTTCCCTCGGGGCTGTGCACAGAGCACTGAGTGTTGGCTTCTGCCCTAGTAAGGGCCACATCAGGCACCTCCGGGTCCACCCACCCAGACTCGTCTGCTCTTGGGGCCAGGGGCCAACTCGGCTGGGTCTGGCGGTGGCAGAGCAGCTGACCTGGAGGGGCCGGAAGGGCAGAGCAGCCCGGCAGAAGCGCAGCAGCCTGGCGAGGACTGGCTGGGGGCACTCTCAGCAGGTGCCCTGGCTGGAGCTCCTGCCTCATCTTCTGGTCCCTGCAATCAGATGCGAGGCCGCGCTGGGCCCTGCGTTCGGCCTGTCCCCCGGCGCCGGGGGAGGCCGGAGGTACCGGCTTCGAGAGCACCGGCCCCCCTCCCGCCTGCTCTGTCATCACCAAGCTAGTTTCGTTTTCAACCAATACTTCACTCGGAAGCTCTGGCATCGCATCATTCATTTGTTTCCTTCTGTCTTTTAGCTAAAGAAAAAGCTTTGTTGTGATTTC