Transcript asmbl_104151

Sequence
Transcript Sequence for observation asmbl_104151 of TGE0004666:
CGGCGGCGGACTCCGCCCCACTGCCACGTTCGACGAAGGATCGCGCGGGGTGCGCGCACCTCTTGGCCAATCGGGAGCCGCAGAGCCGCGGCCTCCGAAAGTGGCAGCCATTCCAGACCCGAGGAAAGTGTAGGAGAAAGCCGCCAGTCACAAGTCGAGGGAGAGAAAGTTCTGCGCTGAGAGCCAATGAGAGGCTGGGGAAGAGTGCGAGCGCGACCCTCTCGGCCAATCCCGGGCCAGGGCACAGGAGGCCTCCGTAGCTATCCCGAATTCAGGGCGGGGGCCGGCGTGGACATCCAATCAGAGCGCGGCGGAGGCGAGCCCCGGAGTGGCTGGCCAATCGGGCGCGGGCGCACGCGGGCGCGCGGGGGGCAGCCGGGTTTATAAGAGCGGGGCGGGCGGTGCGCGCTCTCGAGGCCTCGCTGTCCGGCGGCGCCAACTGAAGCGCCGCTCCCGCTGCCGACATGCTGCGCCGCGTTCTGCTCTGCCTGGCCCTGGCCGCGCTAGGTCGCGCGGGCGCCGACCCCGACGAGGAGGACCACGTCCTGGTGCTGCACAAGGGCAACTTCGAGGAGGCGCTGGCGGCCCACAAGTACCTGCTGGTGGAGTTCTATGCCCCTTGGTGCGGCCACTGCAAGGCCCTGGCCCCCGAGTATGCCAAAGCGGCTGGAAAACTGAAGGCGGAAGGTTCCGAGATCAGACTGGCCAAGGTAGACGCCACGGAGGAGTCTGACCTGGCCCAGCAGTATGGCGTCCGCGGCTACCCTACGATCAAGTTCTTCAAGAATGGAGACACGGCTTCCCCCAGGGAGTATACAGCTGGCAGAGAAGCCGACGACATTGTGAACTGGCTGAAGAAACGCACGGGCCCCGCTGCCACCACACTGCCCGACGAGGCCGCCACAGAGGCCTTGGTGGAGTCCAGCGAGGTGACGGTCATCGGCTTCTTCAAGGACGTGGAGTCGGACTTTGCCAAGCAGTTCCTGTTGGCAGCGGAGGCCATTGATGACATACCCTTTGGGATCACGTCCAATAGTGACGTGTTCTCCAACTATCAGCTGGACAAGGACGGGGTTGTCCTCTTCAAGAAGTTTGACGAAGGCCGGAACGACTTTGAGGGGGAGGTCACCAAAGAGAAGCTGCTGGCCTTCATCAAGCACAACCAGCTGCCGCTGGTCATCGAGTTCACCGAGCAGACGGCCCCGAAGATTTTTGGAGGGGACATCAAGACTCACATTCTGCTGTTCCTGCCCGAGAGTGCGCCTGACCGCGACGGCAAGCTGAGTGGCTTCAAGAAGGCTGCCGAGCGCTTCAAGGGCAAGATCCTGTTCATCTTCATCGACAGCGACCACGCCGACAACCAGCGCGTGCTCGAGTTCTTCGGCCTGAAGAAGGAGGAGTGTCCGGCCGTGCGCCTGATCACCCTGGAGGAGGAGATGACCAAGTATAAGCCAGAGTCAGCCGGGCTGACGGCAGACGAGATCACGGACTTCTGCCAGCGCTTCCTGGATGGCAAGGTCAAGCCACACCTGATGAGCCAGGAGCTGCCTGAGGACTGGGACAAGCAGCCTGTCAAAGTGCTGGTTGGGACCAACTTTGAAGAGGTGGCTTTCGATGAGAAGAAGAACGTCTTCGTGGAATTCTACGCCCCCTGGTGCGGCCACTGCAAACAGCTGGCTCCCATTTGGGATAAGCTGGGAGAGACGTACAGGAACCACGACAACATTGTCATCGCCAAGATGGACGCGACGGCCAACGAGGTGGAGGCCGTTAAAGTTCACAGCTTCCCCACGCTCAAGTTCTTCCCTGCCAGCGCAGACAAGACGGTCATCGACTACAACGGGGAGCGCACCCTGGAAGGCTTTCGCAAGTTCTTGGAGAGTGGCGGCCAGGACGGGGCAGGGGATGACGATGATCTCGAAGACCTAGAGGAGGCAGAAGAGCCCGACCTGGAGGAAGACGACGATCAGAAAGCTGTGAAGGACGAACTGTGATGTCACAACCAGCCCAGCACCCTGACGCGCCCTCGGAGCTGCAGCCCCTCAGCGAGGCTTGGGAGCCCGGGAGCCCGGGCCCCCGGGGAGGAGGCGCACCAGCCAGAAGTGCGGGGGACTTCCTGAGGCGACACCTCACTGACACGCGTAGGCTTAGACCCGCCTCTCCTTCCGCCTTTCCGTTCCTGGAAAGGACCCTCCCCAGGCCAACGTCGGGGCCCATTTTTTTAATTGATGTACTTTTTCGTACACGGTTTCTTCCAGAACGCGCCCAAAAATGTTTGCGAATCTCACGTGGCAGTGTCTCCTTCCCGTTAGGTTTATACTATCACTTTTAAAAATTTCCATCTGTGGGATTCTTGGACATTTTTGGACATCGGGGTCTCTGCTCACCTTGGTCGGGTCACCCTGGAGACCGATGTGCCCTGTGTGGAAAGGGCCCAAGCCATGCTGGACGGGTCACCCCCCTCACACCCATGTTGCTGTGACCGAGTGTGGCTCCCGCAGCGTGTGGTTAAATGGAGACTTCCGGTCTCTGTCGCAGAGGCCGCCATGACTGGGGGGTGCCGGTGGGGCCAAGACAGGGCCTTCTCCCCGAGCCAGGCTCCTCACCGCGGAGGCCTGAGCCGGCCTGAACCAGGACCCTCCACTTCCAGGCTGGGACACAGCCGCGGGAGCTCGAGCCCGGCCAGCCGTTAGCGGTCCTCAGGTCCCTCCACCACAGCGTGGGGACAACTCATTGGCCAAATAAACTTCCAATTTC