Transcript asmbl_103425

Sequence
Transcript Sequence for observation asmbl_103425 of TGE0004615:
GCGGTCGCGTTGGCTGCGCGGGTTGCGGACGGTGCTTTGAACCCGGGGCGGGGGCGGCGGCGGGAGCCGAGGTCGGGGTCGGGATTAGTGTCCGCGTCTGGATCCGGCCCGGGCCGCCGGCACTCCTGGGCGTCCGCTTCCGGGCATGGCGGCCGAGGTGCGCGTTTCGCGCTGGTACTTCGGGGGCCTGGCCTCGTGTGGGGCAGCCTGCTGCACGCACCCGCTGGACCTGCTCAAGGTGCACCTGCAGACGCAGCAGGAGGTGAAGCTGCGCATGACCGGCATGGCGCTGCAGGTGGTGCGCTCCGACGGCATCCTGGCGCTCTACAACGGCCTGAGCGCCTCCCTGTGCAGACAGATGACCTACTCCCTGACCCGATTCGCCATCTACGAGACCGTGCGTGACCAGGTGGCCCAGGGCAGCCAGGGGCCCCTGCCCTTCTACAAGAAGGTGTTGCTGGGTTCCCTCAGTGGTTGCATCGGAGGTCTCGTGGGGACTCCCGCTGACATGGTCAACGTCAGGATGCAGAACGACATGAAGCTGCCCCAGGATCAGCGCCGAAACTACGCGCACGCCCTGGACGGCCTGTACCGTGTGGCCCGAGAAGAGGGTCTGAAGAAGCTGTTCTCGGGTGCGACCATGGCGTCTAGTCGAGGGATGTTGGTGACCGTGGGCCAGCTGTCCTGCTATGACCAGGCCAAGCAGCTCGTCCTCAGCATGGGGTACCTGTCTGACGGCATCGTCACTCACTTCATCGCCAGCTTCATCGCAGGTGGGTGTGCCACGTTTCTGTGCCAGCCGCTGGACGTGCTGAAGACCCGTCTGATGAACTCCAAGGGCGAGTATCAGGGCGTTCTCCACTGCACCATGGAGACTGCGAAACTCGGGCCAATGGCCTTTTACAAGGGCCTCTTGCCCGCCGGCATCCGCCTCATGCCCCACACCGTGCTCACGTTCGTGTTTCTGGAACAGCTTCGCAAACACTTTGGCATCAAAGTGCCGTCCTGATGGGGCCGTGGGAGCGAGCTGGGCCGTGCTGGCCCCCAGTGCCAGTTCTTCCACAGTCCCGGCAAGCCAAGCGCTGCCCTAAGCCCAGCACCTGCCCGCAGGGCTCCAGCCCCCCATTCCTGGCCCAGGACGCCCACCCCGTCCTCCCCCACCTGCCTGGGCTGGAGCTCCTTCCAGGAGCTGTCCCCCCAGCACCCCTCCGCTGTAGCTTCGCCTTGGCCCTCCCTACCTGGCACCCCAGTGGCCCCATCCACGCACCTGTGCCTCACTGGGAGGGGCGGGCTCCAAGTGCAGGTTCAGGCTTCTCCCCTCCCCGAGCAGTCAGCCCTGGCGGGGGAGGGGCAGGCTCCAGGCTTTCTGGGGTCCCCCGCCCCTTCGCCTGAGGCGTTTCTTTCACCGAGCAGCTGCCCAGGGCTCACAGCACCGTCTTCCAGCAGCTTCTTTCAAGGACCTGGGAGGCAGAGCGGGGGGAGTGCAGACCCCCAGCATTGCCCACCAAAGCGTGTGCCTGCACGCGCACTTTATCCTAGGAAAGGGACCATAGCTTTCGTGACGTTCTCGAAGGTAGCTGTGCCCCTGCGCTGCTGGGCAGGTGGCGGAGGAGGCAGGGAACGCAGGGTCTGAGCTGTGGGCCCCTCAGGCCCGTCCCGCCCCAGCCAACCCCCTGTTGCTCTAAGGGTTAGTTTCACCAAAAACCTCAGCGCCAGAGGCGCTGCTGTCTGCAGGGAGCGGAGTGTCTCTCACACCGTCCACGCTGTCCCCTCCGGCCCCCGGGGCAGAGGCGGGCTGTGCCGCGTCCTCGGGGCCCCTCTCTCTGTGGACAGCGATCACCCTTCAGGGCCCCCAGCAGCTGACCAGCCAAAACACCGCCGCCCAGGTTCTGCTGCCAGAGCAGCCTGACCCTGCAAATGGGCCTAGGGACTGTGTCTTCACCCCGGTAGGGGGCCGGCCCACAGGGACACTAATAAAGGACAGGAGCTGCTGTGCGTCTAGTCCTTGCATCCAGTCCCTGCGTCCAGGCTGCTCACTGCTCTGCAGGCCGCCTTGGTGCCTGGGGGCAGCAAGACCCCCCTCTGCACCCCACAATGAGGGCTCTCTGGTTTATGGGGGGCAGGGCCCAGAGGAGGAAGAAGCGACAGCCCTGCCTGGATACACAGGGTAGCCTGTGGCAGAGGGAGGGGTCTGGTCAGCGTTGGTCTTCCAGATCCAAGCCACCATGGATCCCTTTCCAACAAGCACAGGGCTGCAAAGCCCTCAGGTTTGAGAGTTTCCAGCAGGCTGACTTCCGTGGGGGGGCGCTCTTCTGCTATGGGAGGTGCCCCTTGAGTCAGAGCCATGAGCTCTTGGGTGCTGGCGATTGTCCAGCAAGCCCGGAAGGGGCTGGGGAGGCTCTGGTTTGCTGGACTGCAGACTCAGACGGACGGACAGGCTGGGCAGGAGCCAGTGTGGGTACTGCCCTGAGGTCTTGACATCCCAGGACAGGTGGGAGCGGCCCCAGCCAAGAGACACGTGGGACAGATGGTCTGTCGGCAGCCGGTCCAGACACCCTAGTCCTGGGGCATGGAGCATTTCAAGTGTATTAAAAAAAAACCGTTTTGGATAGTGGTGCCGGTTCCACAGTTCCAAATATACTAAAAACCACAACATCCCGAGTTACCTGAAAACAAGCAGCCTGCACCCATGTGTCCGCCCCAGCTGGCCACATCCTCCGTCCTCCAGCCCCCTCCCTGCCCACTGGGTTATTTAGAAGCAAACCCCAGACATTGTGTCATTTATAAATACTTCAGTATGTCTCAAAATAGCCTTTAAAAAATGTAAACTACGATAGTGATTCACTATACGTAAAGAAAGTGTAAAGAAAGTAATTAATGGCCGATCTTCCTGTCATAAGATTTCCAGAATCGCCACTATGTGTCTTTAGAGTTGGTTTTCTTGGGACCGAAGTCAGCCCACGTCTCCAGCCAGCGTGCTTCTTCTGCAGGGTCAGCCAAGTCCTTGGTCCTATTGCTTATCTTGTCAGTTTAGCCCCTTCCTATGTCCTCG