Transcript asmbl_100208

Sequence
Transcript Sequence for observation asmbl_100208 of TGE0004596:
GGAGAACTTGAGGTCGGGGGGATTATCAAAGGCAAAACTGCCGGGACCACCTCCTGAGCAGAGGGGGCTGGACTTCTGAGCCGTGGATTAAGCTCCACCTCACAGCATTAATTTCAAACTGCGCGACCGTTTCTTACCTGCCCTGCGCTAAGGCGGGGGCTGGACTCAATTCCAAGAGAGGGGAATACGCGGGACTCGAGCCTTACGCAATTCACGGATGCTATTTACGCAAGTGACGTCAAGCACTAACCCTATCAATATGGGAGGGAGGAGTACGTACTTGGCGTAGGGAGGGCGTAGAGCGTTCCCGCCATTGGCGGCGGTTAGGGCGTTTACGCAACGGCCTGACGTAAAGACGCGTTAGTTGGGGGGAAGGTTCTAGAAAAGCGGCAGCAGCGGCTCTAGCGGCAGTAGCAGCAGCGCCGGCTTGCTGTGCGGAGGTTCTCCTAGCGGTGTTGTTTCTCCAGCGGCGGCAGTTCTCACTACAGCGCCAGGACGAGTCCGGTTCGTGTTCGACCGCGGAGATCTCTCTCATCTCGCTCGGCTGCGGGAAATCGGGCTGAAGCGACTGAGTCCGCGATGGAGAAAACTTTAGAAACTGTTCCTTTGGAGAGGAAAAAGAGAGAAAAGGAACAGTTTCGTAAACTCTTTATTGGTGGCTTGAGCTTTGAAACCACAGAAGAAAGTTTGAGGAACTACTACGAGCAATGGGGGAAACTTACAGACTGTGTGGTAATGAGAGATCCTGCAAGCAAAAGATCGAGAGGATTTGGTTTTGTAACTTTTTCATCCATGGCTGAGGTCGATGCTGCCATGGCTGCAAGACCTCATTCGATTGATGGGAGAGTGGTTGAGCCAAAACGTGCTGTTGCAAGAGAGGAATCTGGAAAGCCAGGGGCTCATGTAACTGTGAAGAAGCTGTTTGTTGGTGGGATTAAAGAAGATACTGAGGAACATCATTTTAAAGATTACTTTGAGGAATATGGAAAAATTGATACCATTGAGATTATTACTGATAGGCAGTCTGGAAAGAAAAGAGGCTTTGGATTTGTTACTTTTGATGACCATGATCCTGTGGATAAGATTGTGTTGCAGAAATACCATACCATCAATGGTCACAATGCAGAAGTAAGAAAGGCTTTGTCTAGACAAGAGATGCAGGAAGTTCAAAGTTCTAGAAGTGGAAGAGGAGGCAACTTCGGTTTTGGAGATTCTCGTGGTGGCGGTGGAAATTTTGGACCAGGACCAGGAAGTAACTTTAGAGGAGGATCTGATGGCTATGGAAGTGGTCGTGGATTTGGGGATGGCTATAATGGGTATGGAGGAGGACCTGGAGGTGGCAATTTTGGAGGTAGCCCTGGTTATGGAGGAGGAAGAGGAGGATATGGTGGTGGAGGACCTGGATATGGCAACCAGGGTGGGGGCTACGGAGGTGGTTATGACAACTATGGAGGAGGAAATTATGGAAGTGGAAATTATAATGATTTTGGAAATTACAACCAGCAACCTTCTAACTATGGGCCAATGAAGAGTGGAAATTTTGGTGGTAGCAGGAACATGGGAGGACCATATGGTGGAGGAAACTATGGTCCTGGAGGAAGTGGAGGAAGTGGGGGTTATGGAGGGAGAAGCCGATATTAAGCTTCTTCCTATTTGCCATGGGCTTCACTGTATAAATAGGAGAGGATGAGAGCCCAGAGGTAACAGAACAGCTTCAGGTTATCGAAATAACAATGTTAAGGAAACTCTTATCTCAGTCATGCATAAGTATGCAGTGATATGGCAGAAGACACCAGAGCAGATGCAGAGAGCCATTTTGTGAATGGATTGGATTATTTAATAACATTACCTTACTGTGGAGGAAGGATTGTAAAAAATGCCTTTGAGACAGTTTCTTAGCTTTTTAATTGTTGTTTCTTTCTAGTGGTCTTTGTAAGAGTGTAGAAGCATTCCTTCTTTGATAATGTTAAATTTGTAAGTTTCAGGTGACATGTGAAACCTTTTTTAAGATTTTTCTCAAAGTTTTGAAAAGCTATTAGCCAGGATCATGGTGTAATAAGACATAACGTTTTCCTTTAAAAATTTAAGTGCGTGTGTAGAGTTAAGAAGCTGTTGTACATTTATGATTTAATAAAATAATTCTAAAGGAAATTGTGTAATTATAGACTTTTTATTTTAAATAAGTTAAGGAGTGGGTAGTATAATTAAGGTCCATTGCAAAGCTGTTATATTTGTGTAAGATAAATGCTGGTCAGATGTAAGTGTGTTGTCTGCAATTCATCAGGATTAAATTATCTAGATAACTTAAGGGATATCTCTGCAAGGAGAAACACCTTTTTAGATCTTTTAGATGCTGCTTCTTCAATGCAAGGAAAGGAAATAACCCCAGCGAGGTACTCTTCAGGGATACAGGTCTAGTACAAGAAAACTTGACGGCTACTAAGTTCAGCCAGTCTTAAAAAACTGTGCTGTTTCTACAAAGCTTTAACTACAGTAGTTTATAAGGATGCCAACGAAAGCTGAGGGTGTAGAGCAAAATAGTTCTAAGCTTCAGTTAAACTTCTTTAGGTAAGATCTCATTTACTTTTTCTTTCTTAATTTTCCTCCCCAAAAGATAAAACTAATACTCTTCAATGGTCTTCCAGTATAGTGGTTCTTATGTAGTTTAACATAGCTGTAAAATTGAGTTTAACAATTTATAAACTCAAGAGAATAATTTTATACACCCTTGTTTTCCAATCTGTCATTTAAATTATTTTGGTTGTTTTTTCCCTTTTTCCTTCTTTCCCACCCCCTCCCCCTCTATGAAGATTCAGGTGCTTAACATATCATTTTTTTCCCTGCTGGAATTTTAGCATTGATATGAACCGTGGACAAGTATATTCTGCTGCCATAAAGACTGTAAAGTGCTTCATTTCAACAGCTGAGGCAAGCCAAGTGATCATTAATAAAGCTTTTCTTGGTTCCTTCAGTGGTGTTGGTAGTAAAATGGAAGGTGTCTTGCTGCAGGTAACTAATGAAGAAGTGGTCAACCACAGAGTCTTCAAGAAATAAGAAATTCTGTACCATCTGAAAATAGTTCTTGGTGCCTTCATTTAAAAAGCACTCTTTAAGATTAAAGGGAAACGTTTTCTGATAAAAAAAAAAGTCATTTAGTACAGGTTCTTGATATAAAACAATTACAAGTATTGTTTGTGAAAGTTACATCATCAGATAAATGTATCATGTTTTAAATTAGGTTTTGTGAGTAGACAGATCAAAATTCTATTTTAAATACTAAGTTTATAAAATAAATACTTTTGTATCCAAATACTTGGTGTAATGTTTACACATAAAATGTGTGAATCTTGTACTACAAACATTCAGTTGTCTAAAGGATTGCCATCCCCTAGATATATAAAGCAGTTTCACAAAGCTGTGCATATTGCCATTTTCCAATTTTGAGAGATGAGAAAAGCATTGTGGACATTATTGGCAGTCCCTAATAAAAAATGCCATTCTTTATACACTGTATATTCAGCGTTTGAATACTGCTATAGTTTTCTGGCTTTACATTCTATGTTGAATATTGCTGGTGGCGTGTTTAAACATTAATGGATTGTAACCAGCTAAGTGGTCCAAATTAAGTGGGTATGCAAACGCACGAGATAACCTGTCATTCTAGTTTCTCAGTGGTCAATTCTCTTGTATTATACACTGCGTGTCTGGCTTTTTAAAGGGTTAAGTATGATGGATAAAATTTAACGGTGACTTACTTGGCCATTTACCTGAAATAATGAAAACATGAACAACATGATATAGTAAAGGTTGATTTGTTTTACCTACAATTTCTTTTGGTTTTGATATGAGGTATGTCACAGGTAAGTCAAACTAATGGCTAACAGAAGATGAGCTAATAGCTGTATCCATCTAACGCATGTGAGACTACTGGCTTCAAAAAGTACCTAGCTCTACAAATAAAATTAACTTTGAACAAGGTAAATCAACATGGTAAAATCTGAAAGTATGTCATTCTTACACAGCCCAAGTAGGGAAAATTTTCATCTGGTAATGGTGAAACATATTACCTGTGTATTGCTGTTGATTTTCATCTTGAGGTTTAAGGTACTTTTTGTATGACCCTACACTGTTATAAAAGGAATAACTTTGAATACAGGACGCTTCTTATGTTTTCATCTCAAGCTTTACCCTTATTGCTGTGTAACACATTATCAGCAGTTTTAGACCAACAGTAAATTTGCGCCCTCAGTATTTGTGGTTCAAGTTTAAAGCAGTTTAGCTGTGTAATTCTGGCTGAAGCTCAGGATAGATGGCAGGTAACTTGACCACGACTGGAAAATTTACATCCAAAATGGTAGCTGACAGGGTTGGCAAGTTCATTTTGGCTATTTCCATACCCTATAGGTGATCTATCCAAGAAGCCCCCAAATATGGCTTGTTTGGAAGTCACACTATATGGGGTGATGTTGTATGATGACCAAGAGGCAAGCATCGTTGGGGGCTGGTTCTCACATTTTTTCTTACGAAAACTTGATTTATTGCCATGTAAGGTTTTCAGTAACCCAGTGTGGTGTAAATACGTTAGGTTGGCCTGTAAAGGTGATCCTAACAATTTTGTACTAAATGTTTCAATTATCGAGCTAATTTTAGTAATTAGGGAGACTTTAACCGTGCCTCACTTGGTTCAAAAATGGGCAATGACTTCGGAAGATAAACACTAATCTCGGAATACCTAAAAAAAATGACATTCCTAATTTAATGTTGCCAGATAGTTGATAAACCTCATAAAATACTGTCACCACTATTTAGTACTTGTGTTTAATAGCTTTTTGCTAAATAGTTAAACTGGTGTGGTAAGTGGATTAACCAAGAAAGCAAAAGGATGATTCAGCCATATAAAGATGGGTATATCTGCTACCATGAACACAGGCTGACATTTTTTGTTGGGAAGGTTTGCTTCAATCCGGAAATCGGGCTACTATAGGTCGGTGCTGAACTGGATTTGGCTTTGAAAGAACCACATGTTTAGCCTGTCAGAGATCCTGGGCCATATCTTTTTCAACACATTTTACATTGGAGTAAGTTAAGGAATAATTTCCTATAGTTAACAGGAAGTTAATAGTCATGTTGAGAAAAATTATAAATGGAATTTTAGGTTTGGGCCAGTCCACTGGGAAATTCAGAAGAGGAAAAGGTGCCTCAGGGAGGCCAAGGACTAACTGCAAATAGCTGTGTAAGAGCAAACGAATCTTAATGGTCTAGTTTTTAATGGTCCCTTTGTTTTTAGACTTTGTTCCAAATACTTGGGAATACATTTCGTTATGTGGTTACTTTTCCCATAAACCATGTGCTGATTTCTCAGCTCATCTTAATTGCTTATTCATGTTTATAGGGGTTTTTTTGGCGAGGCAACCCTTGGTTGACCT