Transcript asmbl_100204

Sequence
Transcript Sequence for observation asmbl_100204 of TGE0004596:
GGAGAACTTGAGGTCGGGGGGATTATCAAAGGCAAAACTGCCGGGACCACCTCCTGAGCAGAGGGGGCTGGACTTCTGAGCCGTGGATTAAGCTCCACCTCACAGCATTAATTTCAAACTGCGCGACCGTTTCTTACCTGCCCTGCGCTAAGGCGGGGGCTGGACTCAATTCCAAGAGAGGGGAATACGCGGGACTCGAGCCTTACGCAATTCACGGATGCTATTTACGCAAGTGACGTCAAGCACTAACCCTATCAATATGGGAGGGAGGAGTACGTACTTGGCGTAGGGAGGGCGTAGAGCGTTCCCGCCATTGGCGGCGGTTAGGGCGTTTACGCAACGGCCTGACGTAAAGACGCGTTAGTTGGGGGGAAGGTTCTAGAAAAGCGGCAGCAGCGGCTCTAGCGGCAGTAGCAGCAGCGCCGGCTTGCTGTGCGGAGGTTCTCCTAGCGGTGTTGTTTCTCCAGCGGCGGCAGTTCTCACTACAGCGCCAGGACGAGTCCGGTTCGTGTTCGACCGCGGAGATCTCTCTCATCTCGCTCGGCTGCGGGAAATCGGGCTGAAGCGACTGAGTCCGCGATGGAGAAAACTTTAGAAACTGTTCCTTTGGAGAGGAAAAAGAGAGAAAAGGAACAGTTTCGTAAACTCTTTATTGGTGGCTTGAGCTTTGAAACCACAGAAGAAAGTTTGAGGAACTACTACGAGCAATGGGGGAAACTTACAGACTGTGTGGTAATGAGAGATCCTGCAAGCAAAAGATCGAGAGGATTTGGTTTTGTAACTTTTTCATCCATGGCTGAGGTCGATGCTGCCATGGCTGCAAGACCTCATTCGATTGATGGGAGAGTGGTTGAGCCAAAACGTGCTGTTGCAAGAGAGGAATCTGGAAAGCCAGGGGCTCATGTAACTGTGAAGAAGCTGTTTGTTGGTGGGATTAAAGAAGATACTGAGGAACATCATTTTAAAGATTACTTTGAGGAATATGGAAAAATTGATACCATTGAGATTATTACTGATAGGCAGTCTGGAAAGAAAAGAGGCTTTGGATTTGTTACTTTTGATGACCATGATCCTGTGGATAAGATTGTGTTGCAGAAATACCATACCATCAATGGTCACAATGCAGAAGTAAGAAAGGCTTTGTCTAGACAAGAGATGCAGGAAGTTCAAAGTTCTAGAAGTGGAAGAGGAGGCAACTTCGGTTTTGGAGATTCTCGTGGTGGCGGTGGAAATTTTGGACCAGGACCAGGAAGTAACTTTAGAGGAGGATCTGATGGCTATGGAAGTGGTCGTGGATTTGGGGATGGCTATAATGGGTATGGAGGAGGACCTGGAGGTGGCAATTTTGGAGGTAGCCCTGGTTATGGAGGAGGAAGAGGAGGATATGGTGGTGGAGGACCTGGATATGGCAACCAGGGTGGGGGCTACGGAGGTGGTTATGACAACTATGGAGGAGGAAATTATGGAAGTGGAAATTATAATGATTTTGGAAATTACAACCAGCAACCTTCTAACTATGGGCCAATGAAGAGTGGAAATTTTGGTGGTAGCAGGAACATGGGAGGACCATATGGTGGAGGAAACTATGGTCCTGGAGGAAGTGGAGGAAGTGGGGGTTATGGAGGGAGAAGCCGATATTAAGCTTCTTCCTATTTGCCATGGGAAGGTGTCTTGCTGCAGGTAACTAATGAAGAAGTGGTCAACCACAGAGTCTTCAAGAAATAAGAAATTCTGTACCATCTGAAAATAGTTCTTGGTGCCTTCATTTAAAAAGCACTCTTTAAGATTAAAGGGAAACGTTTTCTGATAAAAAAAAAAGTCATTTAGTACAGGTTCTTGATATAAAACAATTACAAGTATTGTTTGTGAAAGTTACATCATCAGATAAATGTATCATGTTTTAAATTAGGTTTTGTGAGTAGACAGATCAAAATTCTATTTTAAATACTAAGTTTATAAAATAAATACTTTTGTATCCAAATACTTGGTGTAATGTTTACACATAAAATGTGTGAATCTTGTACTACAAACATTCAGTTGTCTAAAGGATTGCCATCCCCTAGATATATAAAGCAGTTTCACAAAGCTGTGCATATTGCCATTTTCCAATTTTGAGAGATGAGAAAAGCATTGTGGACATTATTGGCAGTCCCTAATAAAAAATGCCATTCTTTATACACTGTATATTCAGCGTTTGAATACTGCTATAGTTTTCTGGCTTTACATTCTATGTTGAATATTGCTGGTGGCGTGTTTAAACATTAATGGATTGTAACCAGCTAAGTGGTCCAAATTAAGTGGGTATGCAAACGCACGAGATAACCTGTCATTCTAGTTTCTCAGTGGTCAATTCTCTTGTATTATACACTGCGTGTCTGGCTTTTTAAAGGGTTAAGTATGATGGATAAAATTTAACGGTGACTTACTTGGCCATTTACCTGAAATAATGAAAACATGAACAACATGATATAGTAAAGGTTGATTTGTTTTACCTACAATTTCTTTTGGTTTTGATATGAGGTATGTCACAGGTAAGTCAAACTAATGGCTAACAGAAGATGAGCTAATAGCTGTATCCATCTAACGCATGTGAGACTACTGGCTTCAAAAAGTACCTAGCTCTACAAATAAAATTAACTTTGAACAAGGTAAATCAACATGGTAAAATCTGAAAGTATGTCATTCTTACACAGCCCAAGTAGGGAAAATTTTCATCTGGTAATGGTGAAACATATTACCTGTGTATTGCTGTTGATTTTCATCTTGAGGTTTAAGGTACTTTTTGTATGACCCTACACTGTTATAAAAGGAATAACTTTGAATACAGGACGCTTCTTATGTTTTCATCTCAAGCTTTACCCTTATTGCTGTGTAACACATTATCAGCAGTTTTAGACCAACAGTAAATTTGCGCCCTCAGTATTTGTGGTTCAAGTTTAAAGCAGTTTAGCTGTGTAATTCTGGCTGAAGCTCAGGATAGATGGCAGGTAACTTGACCACGACTGGAAAATTTACATCCAAAATGGTAGCTGACAGGGTTGGCAAGTTCATTTTGGCTATTTCCATACCCTATAGGTGATCTATCCAAGAAGCCCCCAAATATGGCTTGTTTGGAAGTCACACTATATGGGGTGATGTTGTATGATGACCAAGAGGCAAGCATCGTTGGGGGCTGGTTCTCACATTTTTTCTTACGAAAACTTGATTTATTGCCATGTAAGGTTTTCAGTAACCCAGTGTGGTGTAAATACGTTAGGTTGGCCTGTAAAGGTGATCCTAACAATTTTGTACTAAATGTTTCAATTATCGAGCTAATTTTAGTAATTAGGGAGACTTTAACCGTGCCTCACTTGGTTCAAAAATGGGCAATGACTTCGGAAGATAAACACTAATCTCGGAATACCTAAAAAAAATGACATTCCTAATTTAATGTTGCCAGATAGTTGATAAACCTCATAAAATACTGTCACCACTATTTAGTACTTGTGTTTAATAGCTTTTTGCTAAATAGTTAAACTGGTGTGGTAAGTGGATTAACCAAGAAAGCAAAAGGATGATTCAGCCATATAAAGATGGGTATATCTGCTACCATGAACACAGGCTGACATTTTTTGTTGGGAAGGTTTGCTTCAATCCGGAAATCGGGCTACTATAGGTCGGTGCTGAACTGGATTTGGCTTTGAAAGAACCACATGTTTAGCCTGTCAGAGATCCTGGGCCATATCTTTTTCAACACATTTTACATTGGAGTAAGTTAAGGAATAATTTCCTATAGTTAACAGGAAGTTAATAGTCATGTTGAGAAAAATTATAAATGGAATTTTAGGTTTGGGCCAGTCCACTGGGAAATTCAGAAGAGGAAAAGGTGCCTCAGGGAGGCCAAGGACTAACTGCAAATAGCTGTGTAAGAGCAAACGAATCTTAATGGTCTAGTTTTTAATGGTCCCTTTGTTTTTAGACTTTGTTCCAAATACTTGGGAATACATTTCGTTATGTGGTTACTTTTCCCATAAACCATGTGCTGATTTCTCAGCTCATCTTAATTGCTTATTCATGTTTATAGGGGTTTTTTTGGCGAGGCAACCCTTGGTTGACCT