Transcript asmbl_99824

Sequence
Transcript Sequence for observation asmbl_99824 of TGE0000166:
CGGGGAAGGAGGACGGTTCAGTTGCTAGGCAACCCGGCCTGGACCCGCCTCTCGCTCGCGTTGCTGGGAGACTACAAGGCCGGGAGGAGGGCGGCGAAAGGGCCCTACGTGCTGACGCTAATTGTATATGAGCGCGAGCGGCGGGCTCTTGGGTCTTTTTTAGCGCCATCTGCTCGCGGCGCCGCCTCCTGCTCCTCCCGCTGCTGCTGCCGCTGCCGCCCTGAGTCACTGCCTGCGCAGCTCCGGCCGCCTGGCTCCCCATACTAGTCGCCGATATTTGGAGTTCTTACAACATGGCAGACATTGACAACAAAGAACAGTCTGAACTTGATCAAGATTTGGATGATGTTGAAGAAGTAGAAGAAGAGGAAACTGGTGAAGAAACAAAACTCAAAGCACGTCAGCTAACTGTTCAGATGATGCAAAATCCTCAGATTCTTGCAGCCCTTCAAGAAAGACTTGATGGTCTGGTAGAAACACCAACAGGATACATTGAAAGCCTGCCTAGGGTAGTTAAAAGACGAGTGAATGCTCTCAAAAACCTGCAAGTTAAATGTGCACAGATAGAAGCCAAATTCTATGAGGAAGTTCACGATCTTGAAAGGAAGTATGCTGTTCTCTATCAGCCTCTATTTGATAAGCGATTTGAAATTATTAATGCAATTTATGAACCTACGGAAGAAGAATGTGAATGGAAACCAGATGAAGAAGATGAGATTTCGGAGGAATTGAAAGAAAAGGCCAAGATTGAAGATGAGAAAAAAGATGAAGAAAAAGAAGACCCCAAAGGAATTCCTGAATTTTGGTTAACTGTTTTTAAGAATGTTGACTTGCTCAGTGATATGGTTCAGGAACACGATGAACCTATTCTGAAGCACTTGAAAGATATTAAAGTGAAGTTCTCAGATGCTGGCCAGCCTATGAGTTTTGTCTTAGAATTTCACTTTGAACCCAATGAATATTTTACAAATGAAGTGCTGACAAAGACATACAGGATGAGGTCAGAACCAGATGATTCTGATCCCTTTTCTTTTGATGGACCAGAAATTATGGGTTGTACAGGGTGCCAGATAGATTGGAAAAAAGGAAAGAATGTCACTTTGAAAACTATTAAGAAGAAGCAGAAACACAAGGGACGTGGGACAGTTCGTACTGTGACTAAAACAGTTTCCAATGACTCTTTCTTTAACTTTTTTGCCCCTCCTGAAGTTCCTGAGAGTGGAGATCTGGATGATGATGCTGAAGCTATCCTTGCTGCAGACTTCGAAATTGGTCACTTTTTACGTGAGCGTATAATCCCAAGATCAGTGTTATATTTTACTGGAGAAGCTATTGAAGATGATGATGATGATTATGATGAAGAAGGTGAAGAAGCGGATGAGGTAATGTTTACCAAATGAGCAAATAATTCTCTGTGGTTAACACATTGAGAAGCAAATTGAATGACTTATGTATTCCTTTGCTATAATCATTCTGTGATTTGGGATAAAAACATTTTGGAAAACATGATTTTAGAATTCTACAGCCAAACAATGTATGTATAAGGTTTCAATAAATAAATTGCAAAACTCAGCAACATTTTTTTATTTCAAATAATTTTGTTCTGCTGCAGGGTTATCAGCTCTTTGAAGAAGTCAAAAGCTGCAGTAAACTTTTCCAACGTTGGCTGCAGTAACTATTTTCAATAAAAGCTGTCTGGATGTCTCAAGTTGTGTTGGGAAATTTTTCATATTAGAAGCTTTCAAATTAAATTGTATTATCATCAAAGTCTGTAATCATGAAAATCTGTTGATCCGTAGAGTAACTTGTATTAAATTTTCCCTACATTATGAGCCAGTTTACCTACTATGTACATACTTCATGGATGCATTTTGAACTTTAATATAGGAAGGGGAAGAAGAAGGAGAT