Transcript asmbl_53678

Sequence
Transcript Sequence for observation asmbl_53678 of TGE0006217:
CGAGCGACCATCTTGCTCCTGCCCCTGACAGACTCTGTTCCAGGTCAGTGGGACGCTAAGACCGCCGAGTGACCCCTCGCTGACCATGTTGTCCCGGGTGGTACTTTCTGCCGCCGCCACAGCAGCCCCCTCTCTGAAAAACGCAGCCCTCCTCGGTCCAGGAGTATTGCAGGCAACAAGGATCTTTCACACTGGGCAGCCGAGTCTTGCCCCTGTACCACCTCTTCCTGAATATGGAGGGAAAGTTCGTCATGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCCAAAACCGGTGTAACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTTCTGTCCAAAGAAATATATGTGGTTACCCCAGAGACCATCTCTGCCATATCAACAATAGGGTTGCTTGTCTATGTAATTAAAAAATATGGTGCCTCTATTGGGGAATTTGCTGATAAACTCAATGAGCAAAAAATTGCCCAACTAGAAGAAGTGAAGCAGGCTTCCATCAAATACATCCAGGATGCAATTGATACGGAGAAGTCACAGCAGGCACTGGTTCAAAAACGTCATTACCTTTTTGATGTCCAGAGGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTGTACAAGGAGGTAAAGAGTCGCCTGGACTACCATATCTCTGTGCAGAATATGATGCGTCGAAAGGAGCAAGAACACATGATAAACTGGGTGGAGAAGCACGTGGTACAGAGCATCTCTGCACAGCAGGAAAAGGAGACAATTGCCAAGTGCATTGCAGATCTAAAGCTGCTTGCAAAGAAGGCCCAAGCACAGCCAGTTCTGTAAATGCGTCTATCCTGATCCAGACAGCTAGAAACAGTTGACTGACTAAATGGAAGCTAGCCTATGGGACAGAATCTTTCTGTACTGCGTTCTACTGAAGTTTCATTTCATCTTACCTGAAAATGAAAAGCTTGGGTTCATATAGAAAGAGAATTAAAACAAT