Transcript asmbl_99336

Sequence
Transcript Sequence for observation asmbl_99336 of TGE0000154:
GCGAGACTCCGTCTCAAAAAAAGGGGAAAAAGGTATAATTTATGCCTTTTCTGGGCAATGCTGGGTCTTTGCTATAGCTGCCCAGTACCCTAAGTCAGACTGAAGATGTACAGTATGGTTTCCGTTAATTGTGTAAGCCGACAAACTACAGGTCCCAGGATAGCTTGAGACTTGTAGTTGCTCACAAAGATGGGTCCGGTGCTGCGGTGCTTCCTGGGAGATGTAGTTTCCTGTGTATTGAAACCTGGACTGCTCGCTGGCCGGCAGCGCACCGTTTTGAAGGTCCTAGCCCACCTGGGCTGGCTCACGCGCACGACTAGCCGCTCCCATACAGCACGCCCGGACTCTGTCGTCGCTTAAGGCCACTCCTATTCTACGGCTGACCCCTGGTGGTCACGTGGATCTGTTCGCCACGCAAGTCTGGGTCCTTCGGCGATTGACCGGGGTCCTTGCTGTTCGGGAGCCTCTCCTAAGCTGCCTGTTCGCGCGAGAGTTTGGAGGGGCGGGTTTGGGGTCGGTGTCTGATTGGGGCTCGCACCGCAGCACGCTGGAGTCCCGCTTAGGTACCAGTTAGCGTCAGGGGAGCTGGGTCAGGCGGTCGCCGGGACACCCCGTGTGTGGCAGGCGGCGAAGCGCTCTGGAGAATCCCGGACAGCCCTGCTCCCTGCAGCCAGGTGTAGTTTCGGGAGCCACTGGGGCCAAAGTGAGAGTCCAGCGGTCTTCCAGCGCTTGGGCCACGGCGGCGGCCCTGGGAGCAGAGGTGGAGCGACCCCATTACGCTAAAGATGAAAGGCTGGGGTTGGCTGGCCCTGCTTCTGGGGGCCCTGCTGGGAACCGCCTGGGCTCGGAGGAGCCAGGATCTCCACTGTGGAGCATGCAGGGCTCTGGTGGATGAACTAGAATGGGAAATTGCCCAGGTGGACCCCAAGAAGACCATTCAGATGGGATCTTTCCGGATCAATCCAGATGGCAGCCAGTCAGTGGTGGAGGTGCCTTATGCCCGCTCAGAGGCCCACCTCACAGAGCTGCTGGAGGAGATATGTGACCGGATGAAGGAGTATGGGGAACAGATTGATCCTTCCACCCATCGCAAGAACTACGTACGTGTAGTGGGCCGGAATGGAGAATCCAGTGAACTGGACCTACAAGGCATCCGAATCGACTCAGATATTAGCGGCACCCTCAAGTTTGCGTGTGAGAGCATTGTGGAGGAATACGAGGATGAACTCATTGAATTCTTTTCCCGAGAGGCTGACAATGTTAAAGACAAACTTTGCAGTAAGCGAACAGATCTTTGTGACCATGCCCTGCACATATCGCATGATGAGCTATGAACCACTGGAGCAGCCCACACTGGCTTGATGGATCACCCCCAGGAGGGGAAAATGGTGGCAATGCCTTTTATATATTATGTTTTTACTGAAATTAACTGAAAAAATATGAAACCAAAAGTACAAACTGTGTTGTCTTTTCATGCCTGGAATTGCCCTTACATTAAGCTTGAAGATAAGGAGTTATATAGACAGGAAAGATAATGGAGGAGAAAGAAGAGTTTTGGGATTGATACAGGATAAAGGTAGGAGAGGCCTGAACCTTTAATTCTTCTACCTTCTGAGATTCCACTCCACTCATAAACTAGATAAGCTTTCAGTCAGTGCCCACTCAATACCACGTCTTTAGAGTCTAATTGTGGAGAATAGAGGAACCTCCATGAGGAAGCAGGGGAACATAGTGTATGGTAGTGTAGAATTCTAGAAATCCCTTGTGTTCATGGCTGTTGAAACATAAAGTAAGACAGGGCTTGGTCTTGAAGGAAATAACGGATATGCATTATTCTTCCTTCCCTGCCCATCCAGATGGAGGGACCAGCAAGAACAGAGACAGGAAGGGGAAAATGGATGTGACCAACTCAGCTGAAAAGTAAGGGCTTTATCGGATAGGGACAGACGAGGTAAGGAAGGTTGTTTAATGAGAGGCCTTGCTTGCCAGCCTAAGCTTTTAAATTTGATGCCAGTGGCAACAATAAAGTGTATCTATCACTAGCCATTGTCAATCTGGACTATAAGTCTGTCCACAATTCTGTGTGTAGAGATTCCAGACTGGGGCATAGGGATGAAAACCTAAAGGATACCTTCTTTTGGGAAATTCTTTTTTTCTTTTTTTTTCTGAGATGGAGTCCCGCTCTGTCGCCTAGGCTGGAGTGCAGTGGTGTGATCTCGGCTCACTGCAACCTCTGCCTCCCGGGTT