Transcript asmbl_99059

Sequence
Transcript Sequence for observation asmbl_99059 of TGE0070927:
TATTTCGGGCTTTCTAAGCGCTAAGATAGTGAGTGGGAGAAGGTGTTCGGGAATTCGGAGCTGGGAAAAACAGTAGTCTCATGGAAAACAACAGAAAAAAACCCCACTCCAGCCTGGTAACCAACGGTTGGCCGGGGGACGTGTCCGCGCTGCTCCCCCTCCGGCCGCCAGGGGGCGCAGGAAGAAGCTTTGGAGGTCTGTCCCGGGACCGCGTACTCGTCCTTCTTTCCCGTTAGTCTTTTCTTCACTTCCGTTGAGTTCCGCCTCGCCGTTTGTCCCTTGCGGTACCCGTCCGCATACGAATCTAGCCCGGGAACCGAGTTGCGGGAGTGCGGTCTGTGCCGTTCCGGCCAGGAGTTTGCCGACTGCAGACGTCCTGCGAACCGGCAAGATGTGCTCTCTGGGGTTGTTCCCTCCTCCACCGCCTCGGGGTCAAGTCACCCTATATGAGCACAATAACGAGCTGGTGACGGGCAGTAGCTATGAGAGCCCGCCCCCCGACTTCCGGGGCCAGTGGATCAATCTTCCTGTCCTACAACTGACAAAGGATCCCCTAAAGACCCCTGGAAGGCTGGACCATGGCACAAGAACTGCCTTCATCCATCACCGGGAGCAAGTGTGGAAGAGATGCATCAACATTTGGCGTGATGTGGGCCTTTTTGGGGTGCTAAATGAAATTGCAAACTCAGAAGAAGAGGTGTTTGAGTGGGTGAAGACGGCATCCGGCTGGGCCCTGGCACTCTGTCGATGGGCCTCTTCCCTCCATGGGTCCCTGTTCCCCCATCTGTCTCTCAGGAGCGAAGATCTGATCGCTGAATTTGCCCAAGTCACAAATTGGTCCAGCTGCTGCTTGCGTGTCTTTGCATGGCACCCCCACACCAACAAGTTTGCAGTGGCCCTGCTAGATGACTCAGTCCGTGTGTATAATGCCAGCAGCACCATAGTCCCCTCCCTGAAGCACCGGCTGCAGCGAAATGTGGCGTCTCTGGCCTGGAAGCCCCTTAGTGCCTCTGTCTTGGCTGTGGCCTGCCAGAGCTGCATTCTTATCTGGACCCTGGACCCTACCTCCTTGTCTACCCGACCCTCTTCTGGCTGTGCCCAAGTGCTGTCTCACCCTGGGCATACACCTGTTACCAGCTTGGCCTGGGCCCCCAGTGGGGGGCGGCTGCTCTCAGCTTCACCCGTGGATGCTGCTATCCGGGTATGGGATGTCTCAACAGAGACCTGTGTCCCCCTTCCCTGGTTCCGAGGAGGTGGGGTGACCAACCTGCTCTGGTCCCCAGACGGCAGCAAAATCCTGGCTACCACTCCTTCAGCTGTCTTTCGAGTCTGGGAGGCCCAGATGTGGACTTGTGAGAGGTGGCCTACTCTATCAGGGCGCTGTCAGACTGGCTGCTGGAGCCCAGATGGCAGCCGACTGCTGTTCACTGTATTGGGAGAGCCACTGATTTACTCCCTGTCTTTTCCAGAACGTTGTGGTGAGGGAAAGGGGTGCGTTGGAGGTGCAAAGTCAGCAACGATTGTGGCAGATCTGTCTGAGACAACAATACAGACACCAGATGGTGAGGAGAGGCTTGGGGGAGAGGCTCACTCCATGGTCTGGGACCCCAGTGGGGAACGTCTGGCTGTGCTTATGAAAGGAAAGCCAAGGGTACAGGATGGTAAACCAGTCATCCTCCTTTTTCGCACTCGAAACAGCCCTGTGTTTGAGCTCCTTCCCTGGTAAGTGCCATGTGGGCCCTTAGGTCTGGACTTCTCACCAGCCTTCCTGCACAAACAAACCCACATCCCACTACATTCAGCTCCCTTCTTGCCTCCGGTTGCCTGCTCACCTTTTCTTCTAGTGGCATTATCCAGGGGGAGCCAGGAGCCCAGCCCCAGCTCATCACTTTCCATCCTTCCTTCAACAAAGGGGCCCTGCTCAGTGTGGGCTGGTCCACAGGCCGAATTGCCCACATCCCGCTGTACTTTGTCAATGCCCAGTTTCCACGTTTTAGCCCAGTGCTTGGGCGGGCCCAGGAACCCCCTGCTGGGGGTGGAGGCTCTATTCATGACCTGCCCCTCTTTACTGAGACATCCCCAACCTCTGCCCCTTGGGACCCTCTCCCAGGGCCACCACCTGTTCTGCCCCACTCCCCACATTCCCACCTCTAAGAATAAATAAGTTTTCCTTTTGTTTTCCA