Transcript asmbl_99055

Sequence
Transcript Sequence for observation asmbl_99055 of TGE0070925:
TATTTCGGGCTTTCTAAGCGCTAAGATAGTGAGTGGGAGAAGGTGTTCGGGAATTCGGAGCTGGGAAAAACAGTAGTCTCATGGAAAACAACAGAAAAAAACCCCACTCCAGCCTGGTAACCAACGGTTGGCCGGGGGACGTGTCCGCGCTGCTCCCCCTCCGGCCGCCAGGGGGCGCAGGAAGAAGCTTTGGAGGTCTGTCCCGGGACCGCGTACTCGTCCTTCTTTCCCGTTAGTCTTTTCTTCACTTCCGTTGAGTTCCGCCTCGCCGTTTGTCCCTTGCGGTACCCGTCCGCATACGAATCTAGCCCGGGAACCGAGTTGCGGGAGTGCGGTCTGTGCCGTTCCGGCCAGGAGTTTGCCGACTGCAGACGTCCTGCGAACCGGCAAGATGTGCTCTCTGGGGTTGTTCCCTCCTCCACCGCCTCGGGGTCAAGTCACCCTATATGAGCACAATAACGAGCTGGTGACGGGCAGTAGCTATGAGAGCCCGCCCCCCGACTTCCGGGGCCAGTGGATCAATCTTCCTGTCCTACAACTGACAAAGGATCCCCTAAAGACCCCTGGAAGGCTGGACCATGGCACAAGAACTGCCTTCATCCATCACCGGGAGCAAGTGTGGAAGAGATGCATCAACATTTGGCGTGATGTGGGCCTTTTTGGGGTGCTAAATGAAATTGCAAACTCAGAAGAAGAGGTGTTTGAGTGGGTGAAGACGGCATCCGGCTGGGCCCTGGCACTCTGTCGATGGGCCTCTTCCCTCCATGGGTCCCTGTTCCCCCATCTGTCTCTCAGGAGCGAAGATCTGATCGCTGAATTTGCCCAAGTCACAAATTGGTCCAGCTGCTGCTTGCGTGTCTTTGCATGGCACCCCCACACCAACAAGTTTGCAGTGGCCCTGCTAGATGACTCAGTCCGTGTGTATAATGCCAGCAGCACCATAGTCCCCTCCCTGAAGCACCGGCTGCAGCGAAATGTGGCGTCTCTGGCCTGGAAGCCCCTTAGTGCCTCTGTCTTGGCTGTGGCCTGCCAGAGCTGCATTCTTATCTGGACCCTGGACCCTACCTCCTTGTCTACCCGACCCTCTTCTGGCTGTGCCCAAGTGCTGTCTCACCCTGGGCATACACCTGTTACCAGCTTGGCCTGGGCCCCCAGTGGGGGGCGGCTGCTCTCAGCTTCACCCGTGGATGCTGCTATCCGGGTATGGGATGTCTCAACAGAGACCTGTGTCCCCCTTCCCTGGTTCCGAGGAGGTGGGGTGACCAACCTGCTCTGGTCCCCAGACGGCAGCAAAATCCTGGCTACCACTCCTTCAGCTGTCTTTCGAGTCTGGGAGGCCCAGATGTGGACTTGTGAGAGGTGGCCTACTCTATCAGGGCGCTGTCAGACTGGCTGCTGGAGCCCAGATGGCAGCCGACTGCTGTTCACTGTATTGGGAGAGCCACTGATTTACTCCCTGTCTTTTCCAGAACGTTGTGGTGAGGGAAAGGGGTGCGTTGGAGGTGCAAAGTCAGCAACGATTGTGGCAGATCTGTCTGAGACAACAATACAGACACCAGATGGTGAGGAGAGGCTTGGGGGAGAGGCTCACTCCATGGTCTGGGACCCCAGTGGGGAACGTCTGGCTGTGCTTATGAAAGGAAAGCCAAGGGTACAGGATGGTAAACCAGTCATCCTCCTTTTTCGCACTCGAAACAGCCCTGTGTTTGAGCTCCTTCCCTGTGGCATTATCCAGGGGGAGCCAGGAGCCCAGCCCCAGCTCATCACTTTCCATCCTTCCTTCAACAAAGGGGCCCTGCTCAGTGTGGGCTGGTCCACAGGCCGAATTGCCCACATCCCGCTGTACTTTGTCAATGCCCAGTTTCCACGTTTTAGCCCAGTGCTTGGGCGGGCCCAGGAACCCCCTGCTGGGGGTGGAGGCTCTATTCATGACCTGCCCCTCTTTACTGAGACATCCCCAACCTCTGCCCCTTGGGACCCTCTCCCAGGGCCACCACCTGTTCTGCCCCACTCCCCACATTCCCACCTCTAAGAATAAATAAGTTTTCCTTTTGTTTTCCA