Transcript asmbl_98564

Sequence
Transcript Sequence for observation asmbl_98564 of TGE0000130:
ATCCAGATATGCTTAATTTGGAAGCAGCTGTAAGCAGACTCCCGGCCAGCTCAAGTTTCCTCACCTGGGAAGAGGCGGGAGGCTGTTTACCGTACGGAAGCATAGCGGCCGCCTGCCTGAGTTCGGGAGCGCGGGTTCCTTTCCGGGAAAGAAGCCTAGGCCGTTTTCCGTACAGCAGCATGGCGGCCGCCGACGGGAGGCGGTCATAGCATCACGCCCGGGGGAAGAGGCCGCCGTAAAGGAAGCTCTGCTTCCTCTTCTTCCTTCTCCCGCCTCCCACCGGCTGTCGTAAAACGGTGAATGGAGAGCGAGTTGTGGGGGGGAAAAAGGGAGGACAGGGGGCGCGGAGTCAGAGTGGCGCAGCAAGTGGCCGCAGGTGGCGACGGTGGCGGGGGGTGGGGTGTGAGGTAATCCAGGGGTCGCGGAAGAGGAGGCTGAGAGGGTCAAAAGAAAACTAAAGCTGCAGTCCGGCCTACTGTTCCGGGGGCCGCGGAGCCCCCACCCGGGGAGATGGACCTCAACCGGATCATCCAGGCGCTGAAGGGCACCATCGACCCGAAGTTGCGGATTGCAGCCGAGAACGAGCTCAACCAGTCCTACAAGATTATCAATTTTGCCCCCAGTTTACTTCGGATTATAGTCTCTGACCATGTGGAATTCCCAGTACGACAGGCAGCTGCCATTTACCTGAAGAACATGGTGACACAATACTGGCCAGATCGAGAACCTCCACCAGGAGAAGCAATATTTCCATTCAACATTCACGAAAACGATCGCCAGCAAATACGTGATAACATTGTGGAAGGAATAATTCGGTCTCCAGATTTAGTGAGAGTCCAATTAACAATGTGTCTCCGTGCCATCATAAAACATGATTTTCCTGGTCACTGGCCAGGAGTGGTCGACAAGATAGACTATTACTTGCAATCACAGAGCAGTGCAAGCTGGCTTGGCAGTTTATTATGCCTGTATCAACTGGTGAAGACATATGAATATAAGAAAGCAGAAGAGAGAGAACCTCTTATAATAGCAATGCAGATATTCCTGCCTCGTATTCAGCAACAAATTGTTCAGCTCCTTCCTGATTCCTCCTATTATTCTGTATTACTGCAGAAACAAATTCTGAAAATCTTTTATGCACTTGTTCAGTATGCATTGCCTCTTCAGCTAGTGAATAACCAAACCATGACAACATGGATGGAGATCTTCCGAACTATTATCGACAGGACCGTTCCTCCTGAGACTCTGCACATTGATGAGGATGATAGACCAGAACTGGTATGGTGGAAGTGTAAGAAGTGGGCACTGCATATTGTAGCTCGGCTCTTTGAACGATATGGAAGCCCAGGAAATGTCACAAAAGAATACTTTGAATTTTCTGAATTCTTTTTGAAAACCTATGCAGTGGGCATTCAGCAGGTGCTACTAAAAATTTTAGATCAATATAGACAGAAAGAATATGTAGCTCCCCGTGTTCTTCAGCAAGCATTCAACTATCTCAACCAAGGGGTGGTTCATTCTATAACCTGGAAGCAGATGAAGCCACACATACAGAATATCTCTGAAGATGTGATTTTTTCTGTGATGTGTTATAAAGATGAGGATGAAGAGCTGTGGCAAGAAGATCCATATGAGTATATAAGGATGAAATTTGATATTTTTGAAGATTATGCTTCTCCCACCACAGCAGCCCAGACTCTCTTATATACTGCTGCAAAGAAAAGAAAAGAGGTGTTGCCAAAAATGATGGCATTCTGTTATCAAATCCTGACAGACCCGAACTTTGACCCTAGGAAGAAAGATGGAGCCCTGCATGTGATTGGTTCCCTAGCTGAGATTTTACTGAAGAAGAGTTTATTCAAGGACCAAATGGAGCTGTTTCTACAAAATCATGTATTTCCATTATTATTGTCTAACCTGGGATATCTTCGAGCTAGATCTTGCTGGGTACTTCATGCATTTAGTTCTTTGAAGTTCCATAATGAGCTCAATCTAAGAAATGCCGTTGAATTAGCGAAGAAGAGCCTGATTGAAGATAAAGAGATGCCTGTCAAAGTTGAAGCTGCCCTTGCTCTTCAGTCTTTAATTTCTAACCAGATACAAGCTAAGGAATATATGAAGCCACATGTGAGGCCTATTATGCAGGAACTGTTGCACATTGTTAGAGAGACAGAAAATGATGATGTTACTAATGTCATCCAGAAGATGATATGTGAATACAGTCAAGAGGTAGCCTCAATTGCTGTTGATATGACCCAACACTTGGCTGAGATATTTGGCAAAGTTCTTCAAAGTGATGAATATGAAGAAGTTGAAGACAAAACAGTAATGGCTATGGGAATTTTACATACCATTGATACTATCTTAACAGTTGTAGAAGATCATAAAGAGATTACCCAGCAGTTAGAGAATATCTGTCTACGGATCATTGATCTTGTTCTGCAGAAACATGTAATTGAATTCTATGAAGAAATTCTTTCCCTGGCATACAGTTTAACCTGCCACAGTATTTCCCCTCAAATGTGGCAGCTTCTAGGTATACTATATGAAGTGTTTCAGCAGGATTGCTTTGAATACTTTACAGACATGATGCCTCTCCTGCATAATTATGTGACAATAGATACAGATACCTTACTATCAAATGCAAAACATTTAGAAATTCTTTTTACAATGTGTAGGAAGGTACTATGTGGAGATGCAGGAGAAGATGCAGAGTGTCA