Transcript asmbl_98481

Sequence
Transcript Sequence for observation asmbl_98481 of TGE0000123:
GTTCCAGGGTCAAGCGGCGCTAAGAGAAGGCGGGACAGAGGAATGGGAAATGACGTGAGGAGTGCGGAGGGGCGCGAGGTTTCAAGATGGCGGTAGCTGAGGGGTTGACCGAGAGACCCAGTTGAAGGCCTTTACGAAGTGAAAGAGGCCGGGAGTCGCCCCCTACCCGCTTCTCGTAGTCCTGGGAGCACAGCAGAAGTGTTTTTCTTTTTTTAATGAACAAGTAAACCATACAAATTGTCAACATGGGACGGAGATCTACATCATCCACCAAGAGTGGAAAATTTATGAACCCCACAGACCAAGCCCGAAAGGAAGCCCGGAAGAGAGAATTAAAGAAGAACAAAAAACAGCGCATGATGGTTCGAGCTGCAGTTTTAAAGATGAAGGATCCAAAACAGATAATCCGAGACATGGAGAAATTGGATGAAATGGAGTTTAACCCAGTGCAACAGCCACAATTAAATGAGAAAGTACTGAAAGACAAGCGTAAAAAGCTGCGTGAAACCTTTGAACGTATTCTACGACTCTATGAAAAAGAGAATCCAGATATTTACAAAGAATTGAGAAAGCTAGAAGTAGAATATGAACAGAAGAGGGCTCAACTTAGCCAATATTTTGATGCTGTCAAGAATGCTCAGCATGTGGAAGTGGAGAGTATTCCTTTGCCAGATATGCCACATGCTCCTTCCAACATTTTGATCCAGGACATTCCACTTCCTGGTGCCCAGCCACCCTCTATCCTAAAGAAAACCTCAGCCTATGGACCTCCAACTCGGGCAGTTTCTATCCTTCCTCTTCTTGGACATGGTGTTCCACGTTTGCCCCCTGGCAGAAAACCTCCTGGCCCTCCCCCTGGTCCACCTCCTCCTCAAGTCGTGCAGATGTATGGCCGTAAAGTGGGTTTTGCCCTAGATCTTCCCCCTCGTAGGCGAGATGAAGACATGTTATATAGTCCTGAACTTGCCCAGCGAGGTCATGATGATGATGTTTCTAGCACCAGTGAAGATGATGGCTATCCTGAGGACATGGATCAAGATAAGCATGATGACAGTACTGATGACAGTGACACCGACAAATCAGATGGAGAAAGTGACGGGGATGAATTTGTGCACCGTGATAATGGTGAGAGAGACAACAATGAAGAAAAGAAGTCAGGTCTGAGTGTACGGTTTGCAGATATGCCTGGAAAATCAAGGAAGAAAAAGAAGAACATGAAGGAACTGACTCCTCTTCAAGCCATGATGCTTCGTATGGCAGGTCAAGAAATCCCTGAGGAGGGACGGGAAGTAGAGGAATTTTCAGAGGACGATGATGAAGATGATTCTGATGACTCTGAAGCAGAAAAGCAATCACAAAAGCAGCATAAAGAGGAATCCCATTCTGATGGCACATCCACTGCTTCTTCACAGCAGCAGGCTCCGCCGCAGTCTGTTCCTCCTTCTCAGATACAAGCACCTCCCATGCCAGGACCACCACCTCTTGGACCACCACCTGCTCCACCATTACGGCCTCCTGGGCCACCTACAGGCCTTCCTCCTGGTCCACCTCCAGGAGCTCCTCCATTCCTGAGACCACCTGGAATGCCAGGACTCCGAGGGCCCTTACCCCGACTTTTACCTCCAGGACCACCACCAGGCCGACCCCCTGGCCCTCCCCCAGGTCCACCTCCAGGTCTGCCTCCTGGTCCCCCTCCTCGTGGACCCCCACCAAGGCTACCTCCCCCTGCACCTCCAGGTATTCCTCCACCTCGTCCTGGCATGATGCGCCCACCTTTGGTGCCTCCCCTTGGACCTGCCCCCCCTGGGCTGTTCCCACCAGCTCCCTTGCCAAACCCTGGGGTTTTAAGTGCCCCACCCAACTTGATTCAGCGACCCAAGGCGGATGATACAAGTGCAGCCACCATTGAGAAGAAAGCCACAGCAACCATCAGTGCCAAGCCACAGATCACTAATCCCAAGGCAGAGATTACTCGATTTGTGCCCACTGCACTGAGAGTACGTCGGGAGAATAAAGGGGCTACTGCTGCTCCCCAAAGAAAGTCAGAGGATGATTCTGCTGTGCCTCTTGCCAAAGCAGCACCCAAATCTGGTCCTTCTGTTCCTGTCTCAGTACAAACTAAGGATGATGTCTATGAGGCTTTCATGAAAGAGATGGAAGGGCTACTGTGACAGCTTTTGATGCCAGAAAAGGCTTCTGTTCACAACAGTGGCCCATGGAGAAAGAGGCTCTTATTAAACTTAGATGAAAGAGCTGCTTCCATTGTCAGGGTATTTTCTAATTTCAGTTCAAGGAATATCCTAAAATTTAGCCTTGTTCAGAATTTACTGCACATAAAAAAGGGTATTTCATCCAGAATAGATCAGTTATTGAAGCAGTGCTGCTAACATCCATTCCCTTTCATACCACCATTTTCACCCTGTTTCTTCCCCTCCTCCAGTTCTTTGGAAATTTGTGATCGGGGGATCTTAGTTGCTTATTTGTTTTGACTCTTGTGTGCTGTGGGCACTGGAGTAGAGATTTCTGGAGAAAAAAAAACAGTTTATTTCATCTTGCCTTTTGTGTTTGAGTTATTTTTAATATTTTCCTGTAAATATTTTGTAATATTTTACTTGTAATGAAATGGATCACAATGTCATTTCCTAATACAAGGCAGGATATGTGGGAAGAATATGTACAATTATTTGATTAAAATTATTTCCCACTGACCTAAACTTTCAGTGATTTGTGGGAAAAATAAATAAATGTTCTACACCAAGATACTCTGTGTTACTGATAATATGTAAACATAATACCTATTTTATGGACAGAAAAAGTTAAATATTTAAAACTTGGGTCTTTAAGGAACTGCCTTTCTGGTACAGAATGAGAATCTTACTGAAAACATGGTAAAAACTACATTTTAAATTTTAAGGGATAAAAAGGAGTAATTATTTCCCTTTTTTAAGATTGTCATACTGGCTTTAGAGAAACTGAGAGGTGTTAAGAATAGTATGGTTTGGCTTTTATTATTTAAAAGATGTCTTACCTTCAGTGGTTACTTATTCCAGAGCTTCTTGAACTGATACGAGTTGAATGGCAAAAGTCATTTTAAACCATTTTTAAGCTATAAAAGAATCAGAAGAGGTTAGCTTTTTTTCCTTTCTGAATTGGTGGGTTTGGTGTGCTTTTATATTAAAATATGAATGAATAAGAGTGCTTAACATTAATTTGCATTTATACCATTTTCTTTACAAAGTGCTTTAATGTAAACTCATCTACCAATTTAGACTAACTCTTAGTAAGTTTAATGTTAATTTAATGACTAACTCATCTACCAATTAACCCTATAGATAACTTTTCTGGGTATTTTCCCCATTTTACATTAGAGAGTATTGAAACTTAAAAAGGACTCGTGATTTATCCAGTGATCCAAAGTGTGTATTTCATAAACACATACACACAGTGCGTGCATTGTTTAGGCATACGTTACTTTCCACAGTATCTCAAATGCCTTTTACATGAATCCCATACTATCAAAAATTGGTGATAACCTAAAATGTAGTGCAATAATACAATAAGGCATTTATTTTCTTAGAGTTGAGTTGATGGATTTTTAGATTTTTATTCAAGATCTTTTGTTTGTTTGGCTTTGCTTGGAAGATACTGATTTATTCTTTCATATTAAAGCAAATCCTGCCAAAGCACTAAATAGACCGTTTTGGGTTGGTTTTTTAGTGTAATATTAATACGGGTCCACAGGTGAATTGAGTCTGTTCAGATGTAAGGATTGAACCTTATGTTATCAATCCTTGACACCATCCTTGATAACTTACGGATATCAAGGATCAAACCATATGGTATCAATATTGTTAGTTATTCAGCATAAACAGAATTATTTCCCAATACTTGATCTGAAATATTTTTAATGGTCTTACTTGAAACTTATATTCTTTCTGGGAGTGATGTTTTTATCATTTTTCCATGGAGACAGGTTCTAACTCTGTTGCCCAGGCTGCAGTGC