Transcript asmbl_98291

Sequence
Transcript Sequence for observation asmbl_98291 of TGE0057178:
GGTTGGAGTTGGTTGAGGTTATTATGGGCTGTCCGTGGGGGGGCGGGGCCTGTGCGGTGGGATTTCCCGGCCGGTGTTTCAGGCCCTTTAAGAGGCGACGCTGGAGCCGGAGCCATTTTCCCCCCTTCGGCCGCGGCGAGGAGGAGCCGGAGCGGGAGTGACACCGAGCCGGACCCAGCGCGACCTGCGGCGGCTCCGGGTGACTCGGGCCAGTGTAGAGGTCCTCAGGCCGCCGGCAGGAGCAGCTGGGCCAATTCCCTGGCCGGGAGCGGAAGGGGATGGCGTCGGGCCTGGGCTCCCCGTCCCCCTGCTCGGCGGGCAGTGAGGAGGAGGATATGGATGCACTTTTGAACAACAGCCTGCCCCCACCCCACCCAGAAAATGAAGAGGACCCAGAAGAGGATTTGTCAGAAACAGAGACTCCAAAGCTCAAGAAGAAGAAAAAGCCTAAGAAACCTCGGGACCCTAAAATCCCTAAGAGCAAGCGCCAAAAAAAGGAGCTGGGGGACAGCTCTGGGGAGGGGCCAGAGTTTGTGGAGGAGGAGGAAGAGGTGGCTCTGCGCTCAGACAGTGAGGGCAGCGACTATACTCCTGGCAAGAAGAAGAAGAAGAAGCTTGGACCTAAGAAAGAGAAGAAGAGCAAATCCAAGCGGAAGGAGGAGGAGGAGGAGGAGGATGATGATGATGATTCAAAGGAGCCTAAATCATCTGCTCAGCTCCTGGAAGACTGGGGCATGGAAGACATTGACCACGTGTTCTCAGAGGAGGATTATCGAACCCTCACCAACTACAAGGCCTTCAGCCAGTTTGTCAGACCCCTCATTGCTGCCAAAAATCCCAAGATTGCTGTCTCCAAGATGATGATGGTTTTGGGTGCAAAATGGCGGGAGTTCAGTACCAATAACCCCTTCAAAGGCAGTTCTGGGGCATCAGTGGCAGCTGCGGCAGCAGCAGCGGTAGCTGTGGTGGAGAGCATGGTGACAGCCACTGAGGTTGCACCACCACCTCCCCCTGTGGAGGTGCCTATCCGCAAGGCCAAGACCAAGGAGGGCAAAGGTCCCAATGCTCGGAGGAAGCCCAAGGGCAGCCCTCGTGTACCTGATGCCAAGAAGCCTAAACCCAAGAAAGTAGCTCCCCTGAAAATCAAGCTGGGAGGTTTTGGTTCCAAGCGTAAGAGATCCTCGAGTGAGGATGATGACTTAGATGTGGAATCTGACTTCGATGATGCCAGTATCAATAGCTATTCTGTTTCTGATGGTTCCACCAGCCGTAGTAGCCGCAGCCGCAAGAAACTCCGAACCACTAAAAAGAAAAAGAAAGGCGAGGAGGAGGTGACTGCTGTGGATGGTTATGAGACAGACCACCAGGACTATTGCGAGGTGTGCCAGCAAGGCGGTGAGATCATCCTGTGTGATACCTGTCCCCGTGCTTACCACATGGTCTGCCTGGATCCCGACATGGAGAAGGCTCCCGAGGGCAAGTGGAGCTGCCCACACTGCGAGAAGGAAGGCATCCAGTGGGAAGCTAAAGAGGACAATTCGGAGGGTGAGGAGATCCTGGAAGAGGTTGGGGGAGACCTCGAAGAGGAGGATGACCACCATATGGAATTCTGTCGGGTCTGCAAGGATGGTGGGGAACTGCTCTGCTGTGATACCTGTCCTTCTTCCTACCACATCCACTGCCTGAATCCCCCACTTCCAGAGATCCCCAACGGTGAATGGCTCTGTCCCCGTTGTACGTGTCCAGCTCTGAAGGGCAAAGTGCAGAAGATCCTAATCTGGAAGTGGGGTCAGCCACCATCTCCCACACCAGTGCCTCGGCCTCCAGATGCTGATCCCAACACGCCCTCCCCAAAGCCCTTGGAGGGGCGGCCAGAGCGGCAGTTCTTTGTGAAATGGCAAGGCATGTCTTACTGGCACTGCTCCTGGGTTTCTGAACTGCAGCTGGAGCTGCACTGTCAGGTGATGTTCCGAAACTATCAGCGGAAGAATGATATGGATGAGCCACCTTCTGGGGACTTTGGTGGTGATGAAGAGAAAAGCCGAAAGCGAAAGAACAAGGACCCTAAATTTGCAGAGATGGAGGAACGCTTCTATCGCTATGGGATAAAACCCGAGTGGATGATGATCCACCGAATCCTCAACCACAGTGTGGACAAGAAGGGCCACGTCCACTACTTGATCAAGTGGCGGGACTTACCTTACGATCAGGCTTCTTGGGAGAGTGAGGATGTGGAGATCCAGGATTACGACCTGTTCAAGCAGAGCTATTGGAATCACAGGGAGTTAATGAGGGGTGAGGAAGGCCGACCAGGCAAGAAGCTCAAGAAGGTGAAGCTTCGGAAGTTGGAGAGGCCTCCAGAAACGCCAACAGTTGATCCAACAGTGAAGTATGAGCGACAGCCAGAGTACCTGGATGCTACAGGTGGAACCCTGCACCCCTATCAAATGGAGGGCCTGAATTGGTTGCGCTTCTCCTGGGCTCAGGGCACTGACACCATCTTGGCTGATGAGATGGGCCTTGGGAAAACTGTACAGACAGCAGTCTTCCTGTATTCCCTTTACAAGGAGGGTCATTCCAAAGGCCCCTTCCTAGTGAGCGCCCCTCTTTCTACCATCATCAACTGGGAGCGGGAGTTTGAAATGTGGGCTCCAGACATGTATGTCGTAACCTATGTGGGTGACAAGGACAGCCGTGCCATCATCCGAGAGAATGAGTTCTCCTTTGAAGACAATGCCATTCGTGGTGGCAAGAAGGCCTCCCGCATGAAGAAAGAGGCATCTGTGAAATTCCATGTGCTGCTGACATCCTATGAATTGATCACCATTGACATGGCTATTTTGGGCTCTATTGATTGGGCCTGCCTCATCGTGGATGAAGCCCATCGGCTGAAGAACAATCAGTCTAAGTTCTTCCGGGTATTGAATGGTTACTCACTCCAGCACAAGCTGTTGCTGACTGGGACACCATTACAAAACAATCTGGAAGAGTTGTTTCATCTGCTCAACTTTCTCACCCCCGAGAGGTTCCACAATTTGGAAGGTTTTTTGGAGGAGTTTGCTGACATTGCCAAGGAGGACCAGATAAAAAAACTGCATGACATGCTGGGGCCGCACATGTTGCGGCGGCTCAAAGCCGATGTGTTCAAGAACATGCCCTCCAAGACAGAACTAATTGTGCGTGTGGAGCTGAGCCCTATGCAGAAGAAATACTACAAGTACATCCTCACTCGAAATTTTGAAGCACTCAATGCCCGAGGTGGTGGCAACCAGGTGTCTCTGCTGAATGTGGTGATGGATCTTAAGAAGTGCTGCAACCATCCATACCTCTTCCCTGTGGCTGCAATGGAAGCTCCTAAGATGCCTAATGGCATGTATGATGGCAGTGCCCTAATCAGAGCATCTGGGAAATTATTGCTGCTGCAGAAAATGCTCAAGAACCTTAAGGAGGGTGGGCATCGTGTACTCATCTTTTCCCAGATGACCAAGATGCTAGACCTGCTAGAGGATTTCTTGGAACATGAAGGTTATAAATACGAACGCATCGATGGTGGAATCACTGGGAACATGCGGCAAGAGGCCATTGACCGCTTCAATGCACCGGGTGCTCAGCAGTTCTGCTTCTTGCTTTCCACTCGAGCTGGGGGCCTTGGAATCAATCTGGCCACTGCTGACACAGTTATTATCTATGACTCTGACTGGAACCCCCATAATGACATTCAGGCCTTTAGCAGAGCTCACCGGATTGGGCAAAATAAAAAGGTAATGATCTACCGGTTTGTGACCCGTGCGTCAGTGGAGGAGCGCATCACGCAGGTGGCAAAGAAGAAAATGATGCTGACGCATCTAGTGGTGCGGCCTGGGCTGGGCTCCAAGACTGGATCTATGTCCAAACAGGAGCTTGATGATATCCTCAAATTTGGCACTGAGGAACTATTCAAGGATGAAGCCACTGATGGAGGAGGAGACAACAAAGAGGGAGAAGATAGCAGTGTTATCCACTACGATGATAAGGCCATTGAACGGCTGCTAGACCGTAACCAGGATGAGACTGAAGACACAGAATTGCAGGGCATGAATGAATATTTGAGCTCATTCAAAGTGGCCCAGTATGTGGTACGGGAAGAAGAAATGGGGGAGGAAGAGGAGGTAGAACGGGAAATCATTAAACAGGAAGAAAGTGTGGATCCTGACTACTGGGAGAAATTGCTGCGGCACCATTATGAGCAGCAGCAAGAAGATCTAGCCCGAAATCTGGGCAAAGGAAAAAGAATCCGTAAACAGGTCAACTACAATGATGGCTCCCAGGAGGACCGAGATTGGCAGGACGACCAGTCCGACAACCAGTCCGATTACTCAGTGGCTTCAGAGGAAGGTGATGAAGACTTTGATGAACGTTCAGAAGCTCCCCGTAGGCCCAGTCGTAAGGGCCTGCGGAATGATAAAGATAAGCCATTGCCTCCTCTGTTGGCCCGTGTTGGTGGGAATATTGAAGTACTTGGTTTTAATGCTCGTCAGCGAAAAGCCTTTCTTAATGCAATTATGCGATATGGTATGCCACCTCAGGATGCTTTTACTACCCAGTGGCTTGTAAGAGACCTGCGAGGCAAATCAGAGAAAGAGTTCAAGGCATATGTCTCTCTTTTCATGCGGCATTTATGTGAGCCGGGGGCAGATGGGGCTGAGACCTTTGCTGATGGTGTCCCCCGAGAAGGCCTGTCTCGCCAGCATGTCCTTACTAGAATTGGTGTTATGTCTTTGATTCGCAAGAAGGTTCAGGAGTTTGAACATGTTAATGGGCGCTGGAGCATGCCTGAACTGGCTGAGGTGGAGGAAAACAAGAAGATGTCCCAGCCAGGGTCACCCTCCCCAAAAACTCCTACACCCTCCACTCCAGGGGACACGCAGCCCAACACTCCTGCACCTGTCCCACCTGCTGAAGATGGGATAAAAATAGAGGAAAATAGCCTCAAAGAAGAAGAGAGCATAGAAGGAGAAAAGGAGGTTAAATCTACAGCCCCTGAGACTGCCATTGAGTGTACACAGGCCCCTGCCCCTGCCTCAGAGGATGAAAAGGTCGTTGTTGAACCCCCTGAGGGAGAGGAGAAAGTGGAAAAGGCAGAGGTGAAGGAGAGAACAGAGGAACCTATGGAGACAGAGCCCAAAGGTGCTGCTGATGTAGAGAAGGTGGAGGAAAAGTCAGCAATAGATCTGACCCCTATTGTGGTAGAAGACAAAGAAGAGAAGAAAGAAGAAGAAGAGAAAAAAGAGGTGATGCTTCAGAATGGAGAGACCCCCAAGGACCTGAATGATGAGAAACAGAAGAAAAATATTAAACAACGTTTCATGTTTAACATTGCAGATGGTGGTTTTACTGAGTTGCACTCCCTTTGGCAGAATGAAGAGCGGGCAGCCACAGTTACCAAGAAGACTTATGAGATCTGGCATCGACGGCATGACTACTGGCTGCTAGCCGGCATTATAAACCATGGCTATGCCCGGTGGCAAGACATCCAGAATGACCCACGCTATGCCATCCTCAATGAGCCTTTCAAGGGTGAAATGAACCGTGGCAATTTCTTAGAGATCAAGAATAAATTTCTAGCTCGAAGGTTTAAGCTCTTAGAACAAGCTCTGGTGATTGAGGAACAGCTGCGCCGGGCTGCTTACTTGAACATGTCAGAAGACCCTTCTCACCCTTCCATGGCCCTCAACACCCGCTTTGCTGAGGTGGAGTGTTTGGCGGAAAGTCATCAGCACCTGTCCAAGGAGTCAATGGCAGGAAACAAGCCAGCCAATGCAGTCCTGCACAAAGTTCTGAAACAGCTGGAAGAACTGCTGAGTGACATGAAAGCTGATGTGACTCGACTCCCAGCTACCATTGCCCGAATTCCCCCAGTTGCTGTGAGGTTACAGATGTCAGAGCGTAACATTCTCAGCCGCCTGGCAAACCGGGCACCCGAACCTACCCCACAGCAGGTAGCCCAGCAGCAGTGAAGATGCAGACTGATACCACCTCCACCGCTGAGCAGTGACCTTCCTCACTTTCTCTTGTCCCAGCTTCTCCCCTGGGGGCCTGAGAGACCCTCACCTTCCTTCTGCCCATCTTCCATGTTGTAAAGGAACAGCCCCAGTGCACTGGGGGAGGGGAGGGAGTGAGGGGCAGTGGTGCCCTTCCTGCAGAAGAGACATGCAGCAGTAGCGCTGGCGCCATCTGCAGGAGCTGGCGGGCTGGCCTTCTGGACCCTGGCTTCTCCCCACTGTAACGCCTGTTACACACAAACTGTTGTGGGTTCCTGCCAGGCTTGAAGAAAATGATCTGAATTTTTTCCTCCTTTTGGTTTTATTTTGTTGGTTTATTTTGTGTTTTCTTTTCTCCTTTTTGGGGGGTATTCAGAGTGGGCTGGGCCCCTGGGCGAGACACAGCTACCTCTGTTGGCATCTTTTTAATACCAGGAACCCAGCGGCTCTAGCCACTGAGCGGCTAAATGAAATAAAGTGG