Transcript asmbl_80453

Sequence
Transcript Sequence for observation asmbl_80453 of TGE0000055:
CGGGGCGGAGTCCTGGGACTCGGGGCGGGACGTGGAACCGGGACGGGTGGGACCTCCGAGCTGGTGCCAGTGGAAGGCGGAGCCCGGCGGCGGGGGGCGGAGCTAGGAGGGTCGGGGGACGGAGCCTGGCTCTTGAAGGAGGAGCTGGAGGAGGTGAAAGGCGGAGCCTCGGGGTCGGAAGCAGAGGGGGACGGAGCGGAGGCGCTGGGGGCGGGGCTTCAGCCGGTGAGTGGCGTGGCTACGGCTCCGGAAAAGGGGTCTAGTTCTGTCGAAGGCGGGGCTGCAGGCCCGGGGGCGGTACCGCGTCCTCCGAAGGGCGGTGCCAAGGAGCCAAGTGAGGAGCCTGGCCCGAGTAATGGCCCCGGGCGTCCTCGCGGGGGTGGTCTCCGTGGTGGCCGGGCTTGGGGACGCCGTAGGCCGAGAACTCCACCGGGAGAGGTGGTGTGGGTGGAGCGGGCTCGGCGGCCAGCAGACACAGGGCCAGTCTGGGTGCCCCGGAGACCCCCAAGGGCTCAGAGTTGGGGCGGCGCCCCGGGCGGAAGCACAGGGCCAGGCTGGGGGGTATCTCCCGAGGACCCGGGCTCCTCGGAGCCACCCAGTGGGGATGTGTGGGTGCCTCGGGGCCGGCCCCCTGCAGCGGCCGCAGAGGTGTTGGTGTGCTGGACCGGGGGCAGCTGGGTGTGGCGTGAGTGGGGCCGCCCAGTCGGGGCAACTGCAGTGCAGCCAGATAGGGTCTGGACTTTGCGTAAAGGGACAGGCGGGAACTGAAGAGCGGAGGTGGGGACTGGGAGGGAGGGAAGGTATGGGGGTGAGCAAAGGGGCGGGTCCCTGGCTGCTGTGGCCTCCCCTGACCCCCTCCCCCCGCTGCTGGGGTCCTCGGCCAAGCCCCCTTCTCACTGGACTGAGACATGAGGCTGAGCTGGTTCCGGGTCCTGACAGTACTGTCCATCTGCCTGAGCGCCGTGGCCACGGCCACGGGGGCCGAGGGCAAAAGGAAGCTGCAGATCGGGGTCAAGAAGCGGGTGGACCACTGTCCCATCAAATCGCGCAAAGGGGATGTCCTGCACATGCACTACACGGGGAAGCTGGAAGATGGGACAGAGTTTGACAGCAGCCTGCCCCAGAACCAGCCCTTTGTCTTCTCCCTTGGCACAGGCCAGGTCATCAAGGGCTGGGACCAGGGGCTGCTGGGGATGTGTGAGGGGGAAAAGCGCAAGCTGGTGATCCCATCCGAGCTAGGGTATGGAGAGCGGGGAGCTCCCCCAAAGATTCCAGGTGGTGCAACCCTGGTGTTCGAGGTGGAGCTGCTCAAAATAGAGCGACGAACTGAGCTGTAACCAGACTGGGGAGGGGCAGGGGGAGAGGCCCCCATCAGGGACCAGACTGTTCC