Transcript asmbl_80452

Sequence
Transcript Sequence for observation asmbl_80452 of TGE0000055:
TGAGTGGTTTGGGGTGGATGAAAGGCCAACCTTGGGCACCACTGCTTTGCCTGCTGAAGCAGGACATTCAGGGGCAGAGTTAACTCAATTGGGCAGCCACTGGGAGGGGCAGCCACCCTAATGGAGGCTTTCTCTGAGGTGTTGGGTCAGAGCATGTGGGTATGATCTTAGTGGGCCTAAGGCAGGAGTGGGTTGAACCAGGAGACAATTCCTGACAGCGATTACTACTTTCAAATCATTTTCTCAGTCATGATGTCACTGGACATGCCATAGGTCAATTAGCATGAGGCAGAAAGGGGTTAGGGCCCCAGAGCTACCGCCTCCAGAGCCCAGTTAGCCCCACCAGTCACGCACAATGCTTCACATGCACCTCCTCACTTTCTCCTCGCTCGATTCTGAGGTCAGCATCATGATTGTCTTCCTTTTACAATTGAGGAAATAGGCTCAGAAAGGCTAACTGGCCGGGGGGATTTGACCTCAACTCAGCTGTCTCCCTAACCTTCAACCTAGGTTTAGCTGCCTCTCAACTGCAGGTTCATTACTTCAGTTGACAGATGTTTGGTGGCTGCTGGGGCGCCTGAAAATAAGTCTGGTGGGGGAACAGGCCCAGCCAGATCATTCCAGTCATGAGTCACAGCCCAGGTGCACAGGTAGAGGGGCCCTGTGGGGTGGGTGTCATCAAGCCCGTGTTACACGCCTGTATTGGATGACAAATTCTACCAAGCACACAGCCGACCGGGAGTTCAAACGTGAGTGTCACTGTGAAGCCCAGGCTCCACAGCGACTGAGGGCCGTGGGCCATGATGAGGCCCGGGAAAACAGGAGTGCTGTGGGAGAGGCTGGGGGCGACTTGAAATGGCGCCTCAAGACCCCCTCCGGGAACCCACGCCCGCCTGACCTTACTATCACCTCGGCCGGAAGTGTCTCCGGCCTTTTCGGAAGTCACTTTCACCTAACCTTACAGACTACCGCTCCGCCGGAAGTGACGCAGGGCAGCGGCGTCGCGGGGGCGGGGCTCGGGAAAGACCCGTGCCAGCGGGCGTGTGGCCGCGGGTTTCGCACGGTCCAATAAGGGAGGGCGGCGTGGCCCGGCCTGGTAGCGACGAGGACGCGCCTGCGCAGAGGCGGCAGCACCACCGGGGTTGACTCCGGGGGCGCGGCGAGGAGAGACATGAGGCTGAGCTGGTTCCGGGTCCTGACAGTACTGTCCATCTGCCTGAGCGCCGTGGCCACGGCCACGGGGGCCGAGGGCAAAAGGAAGCTGCAGATCGGGGTCAAGAAGCGGGTGGACCACTGTCCCATCAAATCGCGCAAAGGGGATGTCCTGCACATGCACTACACGGGGAAGCTGGAAGATGGGACAGAGTTTGACAGCAGCCTGCCCCAGAACCAGCCCTTTGTCTTCTCCCTTGGCACAGGCCAGGTCATCAAGGGCTGGGACCAGGGGCTGCTGGGGATGTGTGAGGGGGAAAAGCGCAAGCTGGTGATCCCATCCGAGCTAGGGTATGGAGAGCGGGGAGCTCCCCCAAAGATTCCAGGTGGTGCAACCCTGGTGTTCGAGGTGGAGCTGCTCAAAATAGAGCGACGAACTGAGCTGTAACCAGACTGGGGAGGGGCAGGGGGAGAGGCCCCCATCAGGGACCAGACTGTTCC