Transcript asmbl_80038

Sequence
Transcript Sequence for observation asmbl_80038 of TGE0000043:
ATGGCCGCCTCAGCAACAGCCCCCCTCCTGTGCGTCACGGACGCGGCGACTCCTGACGTCATAGGAAGGCGCCGGTTTCGGCGGGGGCTGCACGTGCGCAGGGGTGTGGAAACTTACCGGCTGAGCCATGGATACACCGTTAAGGCGCAGCCGACGGCTGGGAGGCCTAAGGCCCGAATCCCCCGAGAGCCTCACCTCAGTTTCGCGGACGAGACGGGCCCTTGTGGAGTTCGAGTCGAACCCAGAAGAAACGAGGGAGCCCGGGTCTCCTCCGAGTGTGCAGCGGGCTGGCCTGGGGTCCCCCGAAAGGCCGCCGAAGACAAGCCCAGGATCACCCCGTCTGCAGCAGGGTGCAGGCTTGGAGTCACCCCAAGGGCAGCCAGAGCCAGGCGCAGCGTCCCCCCAGCGTCAGCAAGACCTACACCTGGAGTCGCCTCAAAGACAGCCAGAGTACAGTCCTGAATCCCCACGATGTCAGCCGAAGCCAAGTGAGGAGGCACCAAAGTGTTCTCAGGACCAGGGAGTACTGGCCTCGGAGTTGGCCCAGAATAAGGAGGAGCTGACCCCGGGGGCCCCCCAGCATCAGCTACCGCCGGTCCCAGGATCACCAGAGCCTTACCCCGGTCAGCAAGCTCCCGGTCCGGAGCCCTCTCAGCCACTACTGGAGCTGACACCCAGGGCACCTGGCTCCCCCCGGGGTCAGCATGAGCCGAGCAAGCCACCTCCAGCTGGGGAGACGGTGACAGGCGGCTTCGGGGCAAAGAAGCGAAAAGGTTCTTCATCCCAGGCCCCAGCGTCCAAGAAGTTGAATAAAGAGGAGCTTCCTGTAATCCCGAAGGGGAAGCCCAAATCGGGGCGAGTGTGGAAGGACCGCTCCAAGAAAAGATTCTCCCAGATGCTTCAGGACAAGCCCCTGCGCACATCGTGGCAGCGGAAGATGAAGGAACGACAGGAGAGGAAGCTGGCCAAGGACTTTGCCCGTCACCTGGAGGAGGAGAAGGAGAGGCGCCGCCAGGAGAAGAAACAGCGCCGGGCTGAGAACCTGAAACGCCGCCTGGAGAATGAGCGGAAGGCAGAGGTCGTCCAAGTGATCCGAAACCCCGCCAAGCTCAAGCGGGCAAAGAAGAAGCAGCTGCGCTCCATTGAGAAGCGGGACACCCTGGCCCTGCTGCAGAAGCAGCCGCCCCAGCAGCCGGCAGCCAAGATCTGAGCTCAGGACGGCCCGAGGCCTTCCATGGCCAACAACCATGTCAGACACAGCACCTCAGGCCGCTGCTCAGATGCCTCTGCTGGAGCTGGCACTCCAAACCCATGGCTCCAGAACAGGGACCCCCACCCCGACCGGGGCTCCTCGGCCTTTGAAGGCTTCCAGGCAGGTCTGTGTGGGACAGAAGCCCAGAGGGGGCCTGGGACCTGGCAGAGATGGGGGCGGGAAGAGATTCAGCTCCCATCCCTCCTTCCTCTCCTTCTCCAAGTGCCTTCAAACCAAGAACTGTACATTCTTCTGGTTCCTCAGTGAGCTGGTGACTGGCAGGTGACTCCCTCAGCAGTGTATGCCCTTTCTCAGCATCCTAGGTCCATCCCAGGCCTGGAGGCTGACAGTTGGGAATCCAGCTTCCCCCACACCTTCCCAAAGGCTGCTCTGAGCACCTCCACACCCCACTGCCTCTGTCCCCAGCAGACTGAATCCGGTTCCTCTCCACTTTTCAATACTGAAAGATTAAAATGGGGAGGTTGCAGGGAGCAGAGCTTTTCCCTAGCACCCACTTTCCCAAACCAGTCTCTGCAGAAGCCCCAGAGAATCTAACTCATGCCTGTCCAGTCTACAGCAAAAATATTTATTGAGTGCCTGTTGCATACAGGCACAATCCTAGGCACCGGCAAATACAGACAATAGACCAAAGTCCCTGCCCTCGAGGAGCTTTCATTCTGATGGAGAGAAAACATAATAAACAAGCAAAATGCAC