Transcript asmbl_79725

Sequence
Transcript Sequence for observation asmbl_79725 of TGE0000035:
GTGGGAGGGGCAGTGGAACTGGAGTCAGCTAATGGCTGACGCACTACGCGCAGAGGGAAAGACGGGTCACCAATAGCGACACGGATATGGCCCCGCGGGCGGGGTTTAGGCCCAAAGTGGTGTCGGAGCAGCGCCTATTAGTGTCATCCTCACCGTCACGGCCGGCGCCTCCTCCTGGATTCATTCACTCGCTCTTTTCATTCACGAAGGTAGTGAGGCCTAGTGGAAAGCCATGGAGAGCGCTCTCCCCGCCGCCGGCTTCCTGTACTGGGTCGGCGCGGGCACCGTGGCCTACCTAGCCCTGCGTATTTCGTACTCGCTCTTCACGGCCCTCCGGGTCTGGGGAGTGGGGAATGAGGCGGGGGTCGGCCCGGGGCTCGGAGAATGGGCAGTTGTCACAGGTAGTACTGATGGAATTGGAAAATCATATGCAGAAGAGTTAGCAAAGCATGGAATGAAGGTTGTCCTTATCAGCAGATCAAAGGATAAACTTGACCAGGTTTCCAGTGAAATAAAAGAAAAATTCAAAGTGGAGACAAGAACCATTGCTGTTGACTTTGCATCAGAAGATATTTATGATAAAATTAAAACAGGCTTGGCTGGTCTTGAAATCGGCATCTTAGTGAACAACGTGGGAATGTCGTATGAGTATCCTGAATACTTTTTGGATGTTCCTGACTTGGACAATGTGATCAAGAAAATGATAAATATTAATATTCTTTCTGTTTGTAAGATGACACAATTGGTACTGCCTGGCATGGTGGAAAGATCCAAAGGGGCTATTCTGAACATTTCATCTGGCAGTGGCATGCTCCCTGTCCCACTCTTGACCATCTATTCTGCAACCAAGACTTTTGTAGATTTCTTCTCTCAGTGCCTCCATGAGGAGTATAGGAGCAAGGGCGTCTTTGTGCAGAGTGTCCTGCCATACTTCGTAGCTACAAAACTGGCTAAAATCCGGAAGCCAACTTTGGATAAGCCCTCTCCGGAGACGTTTGTGAAGTCTGCAATTAAAACAGTCGGCCTGCAATCCCGAACCAATGGATACCTGATCCATGCTCTTATGGGCTCGATAATCTCAAACCTGCCTTCTTGGATTTATTTGAAAATAGTCATGAATATGAACAAGTCTACACGGGCTCACTATCTGAAGAAAACCAAGAAGAACTAAGCATTGATAACTGCATTGTAACTTGGCCAGATGCTCCAGCATATGCACGTTCACTGCAAAGCACCCTACTGGTTTTGAAAATCTGACCTTGTCATTTCAATAGTTATTAACATGACTAAATATTATCTTAATTAAGAGGAAAATAGAAGTTGCTTTTAGGGGTTTCTGACATATATTCTGGATACTATCCGAGGTAATTTTGAAGTTTAATATAAATGCTCATATCAAATGAATATAGAACTAATATTGTCGGGAACACCTAATAGAAAGGAATACTATTATAGCAAATCACAGAATGATAGACTCAAGCATAAAACTTGGCAGTTTTATCTGCTTCAAAATGCCATTGATCATTATTCCTGTATTTTCTCTGAAACTGATTATAAAAACCAATGTCCAGCTACTCTTTTGTTTTTGACACTTGAAGAAATGGAGATCGATTTGATTTGTTTATAAGCAGACACACTGCAATTTACAAAGATCTCTTTACGGTTTTATAAAATTATCTTCCAGTTTGTACATTTATATGGAATTGTTCTTTATCAAGGGTAGCTAATGACATGAAAATAATTGTGAAATATGGAATTATTTCTGACACATGAAGCCCACTAAACTATGCTTTCTTATAATGCATATTTCTTCTCAGTTTAAATGTATGTAAATATCGAAGCTATATGGTATGATTTATAAAGATAAATGGGCCAAAGTGTACATTGAGACTGGCAGCCATCTATGGTACCACTGAAACCCTGACCCAGAAAAGTGGCTTGCTTGGACACCCAGCTGCCTTTGTTTCTGCATTAAACCAATATTGATCACACATATGACACAGGCTAGTCCTATAAAAGTAATGACTTCATAGAAATGGCATTATAATTTTTAAGTTGATACTCTACAGGTAGCTATTGATATAATTAGTTTTAATAAAACATGCTGCAACCATGGTATACAACAAAAATACATTTCTTTGGTGATTGAAATTAAGGCCGTATTTACAATGACTTAATATAAGACTGACTTTTATCCTGCTTCATAACTTGTATGGAGAACTCACCAAGAAAGAATTCAATACTGTGAAATATGCAGCAAGAAGATTGGTCTTTACCTAGGCTGTGTTTCCTAAGCTCTGAGTTTTCAGCACCAGTAGATTTGTATTAAAAGAAAAAAAAATGGGGCCTTAGCTTCTGGCTTTTAATTTTGCCAGCTAAGGACATAAAACAAAAATAAACAAACAAAAACAAATAGCCATCTGCTATCAGCATCATTATGTAAAAGAAAATATATTTTAGCCCCTAAAATTAGGAAGAATGTAATCTCAGAATAAAGGTTGTCATTTAAGTTGAATAAATATATAGCTTTATGAAAAACACATTGTTTGCCCTTTTTTCCTCTCATTTCATTGTAGAAATGGTGACACCACAATGACCTGGACAGTATTTTATCTGCTTTCACACATTGGTTGGTTAGTTGGTTGGTTGGTTGGTTGGTGAGTTGGTTTTAGTGTAGTGGTGGTAGATAGAGGAGGGATTCTCTTGCAAGTATACAAAATACTCTCTTTTTCTTTTATCCCAGTTAGAAAATAGTTGTAGGCTAAGCACAGTGGCTTACACCTGTAAACTCAATGCTTTGGGAGGCTGAGACAGGAGGAT