Transcript asmbl_79429

Sequence
Transcript Sequence for observation asmbl_79429 of TGE0000012:
GAAACCTTTTGTAACTGATTGTTTTGCTTTTCTTTTTGTGGAACTTGAACATTTTTCGTTTTTGAACAGAAAGACTTGTCTGTAGGAACGACAGCTCAGGCAGCCACGTGGGCTGCGGACTGTGTTTGTGGACTACATCTCCCAAAGTGCTCCGCAGGCGCGCCCACAGGAAGTCGCCGGAGCATCTCCCGCCTCCACGCCGAGGCGAAGAGGTTCTATCCGGGGCCTTGGCGCTTCTCTTTCCTTTCGCGCCGGTTGCCGCTGCGGAGCGCGGCGGGTCCATGTGCGCAGTGAGTGGCGCTATTCCTGGCCCAGTAGCACCCGAGCCCCGGGTTTGACCGAGTCCGCGCTGCGATGGACCCCAACACCATTATCGAGGCCCTGCGGGGCACTATGGACCCAGCCCTGCGTGAGGCCGCGGAGCGCCAGCTCAATGAAGCACACAAGTCTCTGAATTTTGTCTCAACACTGCTCCAGATTACTATGTCGGAACAGCTGGATTTACCTGTGAGACAGGCAGGTGTTATCTATCTGAAAAATATGATAACACAGTATTGGCCTGATCGAGAAACAGCACCAGGGGATATATCCCCTTATACTATTCCAGAAGAAGATCGCCATTGTATTCGAGAAAATATTGTAGAAGCCATTATCCATTCTCCTGAGCTCATCAGGGTACAGCTTACTACATGCATTCATCACATCATCAAACATGATTATCCAAGCCGCTGGACTGCCATTGTGGACAAAATTGGCTTTTATCTTCAGTCCGATAACAGTGCTTGTTGGCTAGGAATTCTTCTTTGCCTTTATCAGCTTGTGAAAAATTATGAGTATAAAAAACCAGAGGAGCGGAGTCCATTGGTAGCAGCAATGCAGCATTTTCTGCCAGTTCTAAAGGATCGTTTTATCCAGCTTCTTTCTGACCAGTCTGATCAGTCTGTCCTCATCCAGAAACAGATATTCAAGATCTTCTATGCTCTTGTTCAGTATACACTACCACTGGAACTGATAAACCAACAGAACCTGACAGAATGGATAGAAATTTTAAAGACTGTTGTGAACAGGGATGTACCTAATGAAACACTTCAAGTTGAAGAAGATGATCGACCTGAGTTACCATGGTGGAAATGCAAGAAGTGGGCCTTACATATTTTAGCAAGACTTTTTGAAAGATATGGAAGCCCTGGCAATGTTTCCAAGGAGTATAATGAATTTGCTGAAGTATTTCTGAAGGCATTTGCTGTTGGTGTCCAGCAAGTTTTATTGAAGGTGTTATATCAGTACAAGGAGAAGCAATATATGGCTCCTCGAGTTTTACAACAGACATTAAATTATATTAATCAAGGAGTTTCTCATGCTCTCACCTGGAAGAATCTGAAGCCCCATATACAAGGCATTATCCAAGATGTTATTTTTCCATTGATGTGCTATACAGATGCTGATGAGGAACTTTGGCAAGAAGACCCTTACGAATATATACGCATGAAGTTTGATGTGTTTGAAGATTTCATTTCTCCTACCACTGCTGCCCAGACACTTTTGTTTACAGCCTGTAGTAAGAGGAAAGAGGTACTGCAAAAGACTATGGGATTTTGTTACCAGATTCTTACAGAACCAAATGCTGACCCTCGAAAAAAAGATGGAGCCCTGCATATGATTGGCTCTTTAGCTGAAATACTTCTGAAGAAAAAGATCTATAAAGATCAGATGGAATACATGTTGCAGAATCATGTATTCCCTCTCTTCAGCAGTGAACTAGGCTACATGAGAGCAAGGGCTTGCTGGGTACTTCACTATTTTTGTGAAGTGAAGTTCAAAAGTGATCAGAACCTTCAAACAGCCTTAGAGCTAACAAGAAGATGTCTGATTGATGATAGAGAAATGCCTGTGAAAGTGGAAGCTGCCATTGCCCTTCAAGTATTGATCAGCAATCAAGAAAAAGCTAAAGAATATATCACACCATTCATCAGACCTGTAATGCAGGCTCTTCTTCACATTATAAGAGAAACAGAAAATGATGACCTTACCAATGTAATTCAGAAAATGATCTGTGAATATAGTGAAGAAGTTACTCCTATTGCAGTAGAAATGACACAACATTTGGCAATGACATTTAACCAAGTAATCCAGACGGGGCCAGATGAAGAAGGTAGTGATGACAAAGCAGTTACTGCTATGGGAATTCTGAATACAATTGATACACTTCTTAGTGTAGTTGAAGATCATAAAGAGATAACCCAACAGCTTGAGGGAATCTGCTTACAGGTCATTGGTACTGTTTTACAACAGCATGTCTTAGAATTCTATGAGGAGATCTTCTCTTTAGCGCACAGTTTGACATGTCAACAAGTGTCTCCACAGATGTGGCAGCTACTACCCCTTGTATTTGAAGTCTTTCAGCAAGATGGCTTTGATTACTTTACAGATATGATGCCCCTCCTTCATAATTATGTAACAGTTGATACAGACACACTTCTGTCTGACACCAAGTATCTTGAAATGATATACAGTATGTGCAAAAAGGTTCTTACAGGAGTTGCAGGAGAAGATGCAGAGTGTCATGCAGCAAAATTGTTAGAGGTCATCATTCTGCAGTGCAAAGGGCGTGGCATTGACCAGTGCATTCCCTTATTCGTGGAAGCAGCCTTAGAAAGACTGACAAGAGAGGTTAAGACAAGTGAACTTCGAACTATGTGTCTGCAAGTTGCAATTGCAGCTTTGTATTATAATCCACACCTACTACTCAATACCTTAGAAAATCTTCGCTTCCCTAATAATGTTGAACCAGTTACAAATCATTTTATTACACAGTGGCTTAATGATGTTGACTGTTTCTTGGGGCTTCATGACAGAAAGATGTGTGTTCTCGGACTCTGTGCTCTTATTGATATGGAACAGATACCCCAAGTTTTAAATCAGGTTTCTGGACAGATTTTGCCGGCTTTTATCCTTTTATTTAACGGATTGAAAAGAGCATATGCCTGCCATGCAGAACATGAGAATGACAGTGATGATGATGATGAAGCTGAAGATGATGATGAAACCGAGGAACTGGGGAGTGATGAAGATGATATTGATGAAGATGGGCAAGAATATTTGGAGATTCTGGCTAAGCAGGCTGGTGAAGATGGAGATGATGAAGATTGGGAAGAAGATGATGCTGAAGAGACTGCTCTGGAAGGCTATTCCACAATCATTGATGATGAAGATAACCCTGTTGATGAGTATCAGATATTTAAAGCTATCTTTCAAACTATTCAAAATCGTAATCCTGTGTGGTATCAGGCACTGACTCACGGTCTTAATGAAGAACAAAGAAAACAGTTACAGGACATAGCAACTCTGGCTGATCAAAGAAGAGCAGCCCATGAATCCAAAATGATTGAGAAGCATGGAGGATACAAATTCAGTGCTCCAGTTGTGCCAAGTTCTTTCAATTTTGGAGGCCCAGCACCAGGGATGAATTGAGTTATCTCTTTCTTTCCTGCTGTGTGCTTGTAGTGAAGAGCTTGTGTTCCTCCTAGTAGTGGTTCCAGAACTGGTTCATGTTATCTATTCTAAACTAATAATCAATAGATGGACAAAAGAAACAACAACCCCAGGAGATGGGACCTGATCATGCAACCTGGCACTGGAAAAGAAATCAGCGGGATTTTGGGGGTGGGGGGGGATGGGAGGTACCTTAGAGGGAGTATTTTCTTTATTTTTTGAAGAAAGTAAGATCCTGACTCTGAAGCTTCAAAGTGACACTGTGGAAATCTGAAACGAGGGGATGTCATGAAGGCAGCTTTTCTTTTTCTGAGGAAAAAATAGGCATGGGCTACAGGACTATTTAAAATGTCTCATTTACAGTATAAAACTCAAAGGTAGATGTAATTTTTACACCTATGAGTATTTGTCCAATTTCTGTCTCTTCCTCACCATTGGGTATCTATTCTTTATATGTAAATAAGATAAGGTCATCTGATAGCCTTATTCAGTCTTCATCATTTTCATCATTGTTCCTATGTAGATTATTGGACATTTATTGTAGCACTACATAACTGATTATAAAAATCTGTAAATGAATTAGCACTTTCATATTGAAACAAGCCTGCTAGCCTATGTATAAAATAGCAAAATGTTTGCTGTTTATAAAAAGATGTAATGGGGTGGGGGGCAGGGGTAATTTCAAGTTATTAATTTAAAAATGAACTAGCAATTTTGTACCTGGTGACTTTGTGGTGCACTCACCTCTGATAGTGACTTGAATTCGGTATGTAAAAAGGGGTTAGTGGTATTTCATTGCTGCTAAAAATGACAACTCCCTCTGTGTCCTGTTTTTCTTAAAGCTGTCAGTGTACAAGTGGGTATTTGAATACCAGACCTTACTGTAAAAAATAAAAAAGGTGGTATCTAGAGCATGTAAATTGGATATAAAGTTCTGCTCTTAAAGAGTTGATCTAAGAGTATGGCTAAACATCTATATATGCAATCTATTAAAAGAACTTAATTCGGCTATTATGTCTTGATTTGATTGCAGTTTTTTCCTAATTATAACAAATTTTTCCTCATTGGCCTGTTTTTAATCCTGTGCCTAGAAGGAGTACAAAATGCACACTTTACAAAATTGATATTTAACACTTACCCACTCCCCTTTCCCCATCTCTTCTACCGCTCTTGTTGATCGTGGTATCTGATCTTGACTAGATAGGCTGAAGGCACATGGTTCCCTCCAAAAACCACTATTGATACCACTACAAAAACAAGCCAGCAAAAAGATACTGTAGAGAGGTTGGCTTGCTTCCCTCTCTTCCTAACTGCATGTTGAAAAATAAGCCGTTATTGATCTTAAACATCGGTCAGATGAGTCATACATTGGGTTATTTTTTATATACATGTATACACAAAATATTTCAAATTGAAAGCAACATCTTAATGGATTCAAAACTATTACAAGCTGTTGTCTAAAACAGGTGAGAAAAAAATTTATAACTGTAAAAACAAATGCACATATTGATATTTAAAATGCGTAATTAAGAAAACCCATTGTTGTTGTGTTTTTCTTGTATACCAATAATTAAGCCACTACTGTTGGCACTGTTTGGTTTTCTATTTTAACACTGAAGGAGTGAAAGTATTTCCTATATTTATGAATTTACTACTAAAATCTTGGCAAAAAAAGAAAAAAATTGTCTAACGTGTGTGGGTGAAAACTGTTAATCAAGTGTTTCTACTCCCCCCCGAAAATCCCCTGAAAGTTGGACACCAACTGTATACCCTAGGTTGCTTAAAGGGATTTCACTATTATATAAAGTCAATAAAAATGAAGTAGTTGTATATATGCAACATTGTGTACAGAGGGGAAATAATGAATAGTATTAAAGAAACATTCTCGTCTTCCTTTACCTTTAATCCCCTAATACCTAGTCTACTTTTTAAATTTTCAGACTTCACTGCTTTTTGAATTCATAATTCTAATTTTCACATTATTGTTAATGGAAAATCATATCTAATAAAGGTTTTAGTTATTCCCATGCACAGTATGAAAATTCTCATTTGCTGAGGTTTTGTTTCAAGAAAATGTATTGGCATGTCTTTGAGAACATGTTTTATTGTCTCCTGTGTCATATAATCCAAACTAATCTCCGTTTACAGACTTTAACTTGAAATTAGACCTTATAATTAAACTATTTAAATAGTGTTCAAATGATAGTTTCTAATGCATCAAATATATACCTCAGTTTTCATGATTTCCTTTAACATTATAATTTGGTATAGATCAAGAATCTTAACATGTATCAGTTTCTAGATGAGGCTGCAGGATTTTTGGAAAACTTTTTGAATGTATTTACAATATTCTCTTGTAATTAGCTACATAGGGACTTGTCTTTTTTTCTTTTTACATACAGCTTTTCCTACAGTTTTATTACCCTGTAATTTTTTTTTAGTTGTAGAAGTTAATTCTGATTTTGTGTGGATTTCAGTATTTGTCTTTGTTAATGGCACATATTAGCATAAATCACTTTTGTAAATGTAAGCTTTCTTTTTTTTTCTTGAAAAAGCCTTTCTATTTATCAGTATTAAATAAAGGAAGTTAATCTGTTTCTCTGCAGGTAATAAAATAGTGACACACTGTATTAAGATAGTGACTGCTATACTCAACTCTGGAAGAGACTAGAGTATAGAGCATGAGTGGCAAAACCACAGCCCTTGGGCCATATGCTGCTATTCAGTCCCAGATGTAGCCCCTGAAGCAAGCATAAAGAAAAATGAATTAAAAATTAAATTAATATGGAAAGTTAAAAAATGGATTACATTAGTATGACTAAACCATGTCTTTGGCAAAGATCTAACACAATGTCTTAAGTATAATAGGTAGTCTCTGTTTGTAAAATAAATGACTTAAATTTAAAACATCA