Transcript asmbl_78713

Sequence
Transcript Sequence for observation asmbl_78713 of TGE0000004:
TTTTCAACCCGGATGGCGGTGATAGTTAATACTTTCTGAGCGCTTTTACTATGGTCAGGCATTATATTTACACCTAATCCTCGCAAAACACTACTGGGAAGATCCTCATTTGACAGGAGCAATTCCGGGTCACAAAGGCTGACACCACAAAGCTAGTCCGTAGCGGGTTCGACCACAGGCGCCCACACTCTTTGACGCCTCAATGGCACAGCCAAGTGCGCGGGAAGTGGGCTGCAAACGCCGGAGAGTTTTGTCCGGAGCGCAGAGACGCGCTGTAACCGAGCAACCAGCGGGGCCCGCCCCCGGCCTGCTACGGCGCTCCCAGCCTGCCCCGCGCCGCTCGGCGCCGGAAGTGAGTGAGCATTTCCGGCAGCCATCCCCGCGGTGCTGACATCCCGGTTGTTCTTCTGTGCCGGGGGTCTTCCTGCTGTCATGAAGGACGTACCGGGCTTCCTACAGCAGAGCCAGAACTCCGGGCCCGGGCAGCCCGCTGTGTGGCACCGTCTGGAGGAGCTCTACACGAAGAAGTTGTGGCATCAGCTGACACTTCAGGTGCTTGATTTTGTGCAGGATCCGTGCTTTGCCCAAGGAGATGGTCTCATTAAGCTTTATGAAAACTTTATCAGTGAATTTGAACACAGGGTGAACCCTTTGTCCCTCGTGGAAATCATTCTTCATGTAGTTAGACAGATGACTGATCCTAATGTGGCTCTTACTTTTCTGGAAAAGACTCGTGAGAAGGTGAAAAGTAGTGATGAGGCAGTGATCCTGTGTAAAACAGCAATTGGAGCTCTAAAATTAAACATCGGGGACCTACAGGTTACAAAGGAAACAATTGAAGATGTTGAAGAAATGCTCAACAACCTTCCTGGTGTGACATCGGTTCACAGTCGTTTCTATGATCTCTCCAGTAAATACTATCAAACAATCGGAAACCACGCGTCCTACTACAAAGATGCTCTGCGGTTTTTGGGCTGTGTTGACATCAAGGATCTACCAGTGTCTGAGCAGCAGGAGAGAGCCTTCACGCTGGGGCTAGCAGGACTTCTCGGCGAGGGAGTTTTTAACTTTGGAGAACTCCTCATGCACCCTGTGCTGGAGTCCCTGAGGAATACTGACCGGCAGTGGCTGATTGACACCCTCTATGCCTTCAACAGTGGCAACGTAGAGCGGTTCCAGACTCTGAAGACTGCCTGGGGCCAGCAGCCTGATTTAGCAGCTAATGAAGCCCAGCTTCTGAGGAAAATTCAGTTGTTGTGCCTCATGGAGATGACTTTCACACGACCTGCCAATCACAGACAACTCACTTTTGAAGAAATTGCCAAAAGTGCTAAAATCACAGTGAATGAGGTGGAGCTTCTGGTGATGAAGGCCCTTTCGGTGGGGCTGGTGAAAGGCAGTATAGACGAGGTGGACAAACGAGTCCACATGACCTGGGTGCAGCCCCGAGTGTTGGATTTGCAACAGATCAAGGGAATGAAGGACCGCCTGGAGTTCTGGTGCACGGATGTGAAGAGCATGGAGATGCTGGTGGAGCACCAGGCCCATGACATCCTCACCTAGGGCCCCCTGGTTCCCCGTCGTGTCTCCTTTGACTCACCTGAGAGAGGCGTTTGCAGCCAATGAAGCTGGCTGCTCAGACGGTCGACATTGAATTTGGGTGGGGGTTGGGATCCTGTCTGAAGTACAGACTGTTCTTGCTCTAAAAACAGGACTGTCCCTGATGGGAGCCAGGCCACAGGGAGGAGGCTTCTTTGTGGGTCTCTCCTGCAGAGGGTGGGGGTCTCAGGGTCTTAGGTGATACGGGAGAGAAAGAACGTGCCAGGCAGGAGGCCCCCTGAAGTCTGTGTACTCCGAGGTGGATCTCCATCCCCATCCACCTGTACGGACATCTTTTCCGTTGCGGTTTGAGAATGTTCCTATAATAAACCCCTCTGCTTTGTT