Transcript asmbl_61299

Sequence
Transcript Sequence for observation asmbl_61299 of TGE0000105:
GTTCTGGTCGGGGCAGGCAGCGGCGGCCGCGGCGGGGCCTGGGGCTTGGGGCCTGGAGCCCGGGCCTGGGGCGCTGGCGGGAGGCCCCTCCCAACTCCCGGCGCGCCTCGCCCGGCTGCCCGCCTCACTGAAGGTCAAGGCGCTTTGTTCTGCGCCGCGGGCGGCCTCCTGGGCGGCGGCCCCTTGGAGGAGGCGAAGACGGCGAGAGGCGGCGGCCGCTCAAATCTCCCGCTAGCCCAGCCCGCCCCGCGTGCGGGGGCTGTGGCGGTTACACGGCCGGGCGCGCCGGAGCGTTCAGGCTTCCCGTTTTTAAGGAAGTAGCTGATCTCTGCAGGAAACTGCTGTTACCTGGCCTCAGCTGAATTTTTGTGGGACCTCCTGAGGGGATAAAAACATTCAGATGGCAGATCACAGTTTTTCAGATGGGGTTCCTTCAGATTCCGTGGAAGCTGCTAAAAATGCAAGTAACACAGAAAAGCTCACAGATCAGGTGATGCAGAATCCTCGAGTTCTGGCAGCTTTACAGGAGCGACTTGACAATGTCCCTCACACCCCTTCCAGCTACATCGAAACTTTACCTAAAGCAGTAAAAAGAAGAATTAATGCATTGAAACAACTTCAGGTGAGATGTGCTCACATAGAAGCCAAGTTCTATGAAGAGGTACATGACTTGGAAAGAAAGTATGCAGCGCTATACCAGCCTCTCTTTGACAAGAGAAGAGAATTTATCACCGGCGATGTTGAACCAACAGATGCGGAATCGGAATGGCACAGTGAAAATGAAGAGGAAGAGAAATTGGCTGGAGACATGAAAAGTAAAGTAGTCGTCACAGAAAAAGCAGCGGCAACGGCTGAAGAGCCAGATCCCAAAGGAATTCCAGAGTTCTGGTTTACCATCTTCAGAAATGTGGACATGCTGAGTGAATTAGTCCAGGAATATGATGAACCAATCTTGAAACACCTGCAGGATATTAAAGTGAAATTTTCTGACCCTGGACAGCCTATGTCTTTTGTGTTAGAGTTCCACTTTGAACCCAACGACTACTTTACCAACTCAGTCCTGACAAAAACCTACAAGATGAAATCAGAACCAGATAAGGCTGATCCCTTTTCCTTTGAAGGTCCTGAGATTGTGGACTGTGACGGGTGTACTATTGACTGGAAGAAAGGAAAGAATGTTACTGTCAAAACCATCAAGAAAAAGCAGAAGCATAAGGGTCGAGGCACTGTTAGAACAATTACGAAACAAGTACCCAATGAGTCCTTTTTCAACTTCTTCAATCCATTGAAAGCATCCGGGGATGGAGAATCACTGGATGAAGATTCTGAATTCACATTAGCCTCTGATTTTGAAATTGGACACTTTTTCCGTGAGCGGATAGTCCCGCGGGCTGTGCTGTACTTCACTGGGGAGGCCATAGAAGATGATGACAATTTTGAAGAAGGTGAAGAAGGAGAAGAGGAGGAATTAGAAGGTGACGAGGAGGGAGAAGACGAGGATGATGCGGAAATTAACCCCAAGGTGTAATTTTTGTCTGTTAATCATTCATACGTTTCTAGAAGGAACCCAGCCAGCCGGCGGAATGCAAGCAGCAGTAGGAAGCGGAGGCGGGTGCCTGGCAGACCGGCTGTCGGGACTCCAGGCCTGTGGGCGGGGCCTCGGTCCTTGCCGCAGCACAATCCCGTGGACAGAGCTTACTCCATCTAACTCGTTTTCAAGTGCATGATTTTCACTTTCACTTTTCCTTTTTCCTTATTATTTTGCTTAACTTGTACAGTGGCAACTGAAATGCATTTCAGAAATAGGAGGTTTCGTCCAGCACCCTCTGCAGCCTTGGTGCCTGTAGCTCTGGACTTCCCTGGGCCTTTCCCTGTGGGAGGGCCCTGTAGACCACATCAGGGTGGGGTGGGGGTCACTTGGCAAAAAGGGCCGAGGTCTGGTGATGTGGTTCCCAGGATCTGGAACCTCTCCCACCCCTCCTGCAGTTGGACTGAATTCTTCCCTTTCATCCGAAGAAACCCACTTGCTGTTTCCAGCCGCTGAATCTGCTGAGTGTGCAGCCTGCATCACCTGCTGTATGCCGATCATCTCAGAAAGGGCTGTGTAGAGTAGGGCCCTGTTCTCCTTAGGATGTTGCTTCTT