Transcript asmbl_53103

Sequence
Transcript Sequence for observation asmbl_53103 of TGE0006146:
CAGAGGAGTAGGAGGTGGAGGAGGAGAGGTCGGAGCCGTCTCCAGGAGCCCTTAGAGACCGAGTCCCCGGCGGCGGCGGCGGGGCAGCGCACGGGCGGACTAGTGAGCACCGAGGGGCAGGCGCAGGAGATTCATTCTCCCCACTTGAAACCTGAAAAGAGTGGGCCACACAAAGTCTTACTGGTTCCAGGTGAAAACAGTAACTGAAGATGTCAAGCAAAACAGCAAGCACCAACAACATCACCCAGGCACGGAGAACTGTGCAGCAGTTAAGACTAGAAGCCTCCATTGAAAGAATAAAGGTTTCAAAGGCCTCAGCGGACCTCATGTCCTACTGTGAGGAGCATGCCAGGAATGACCCTTTGCTGATAGGGATACCTACTTCAGAAAACCCTTTCAAGGATAAAAAAACTTGCATCATCTTATAGAGGAGTGAAATGGTTCCTCACGTCTTCT