Transcript asmbl_52222

Sequence
Transcript Sequence for observation asmbl_52222 of TGE0006121:
GACCGTTTAGGACGCCCTCCTGAGCATCGCGTGAACTGGGTCGCGGGAGGCCTCCGCCAAGGAGCCTAGAAAGATTGTGCGATGAATGGTGATACTCGAGCCGTCGTGGTGACCTCACCACCCCCGACCACAGCCCCTCACAAGGAGAGGTACTTCGACAGAGTGGATGAGAACAATCCAGAATACCTGCGAGAGAGGAACATGGCCCCAGACCTTCGCCAGGACTTCAACATGATGGAACAGAAAAAGAGGGTGTCCATGATTCTGCAGAGCCCCGCCTTCTGTGAAGAATTGGAATCAATGATACAGGAACAATTTAAGAAGGGGAAGAATCCCACAGGCCTGTTGGCATTACAGCAGATTGCAGATTTCATGACCGCCAATGTACCCAGCGTCTACCCGGCAGCCCCACAGGGAGGGATGGCAGCCTTGAACATGAGTCTTGGTATGGTAACTCCTGTGAATGACCTTAGAGGATCTGATTCGATTGCCTATGACAAAGGGGAGAAATTACTGAGGTGTAAATTGGCAGCGTTTTACAGACTAGCAGATCTCTTTGGATGGTCTCAGCTTATCTACAATCATATCACAACCAGAGTGAGCTCCGAGCAAGAACACTTCCTCGTTGTACCTTTTGGACTTCTCTACAGTGAAGTGACTGCATCCAGTTTGGTGAAAGTCAGTCTGCAAGGAGATATCATAGACCGTGGAAGCACTAACCTGGGAATAAATCAGGCCGGCTTCATGTTACATTCTGCCATTTATGCTGCACGACCCGACGTGAAGTGCCTTGTGCACATTCACACAGCAGCGGGGGCTGCGGTCTCGGCGATGAAATGCGGCCTCTTGCCCATCTCTCCGGAGGCGCTTTCCCTTGGAGAAGTGGCTTACCATGATTATCATGGCATTCTGATTGACGAGAAGGAAAAAGTTTTAATTCAGAAAAATTTGGGGCCTAAAAGCAAGGTCCTTATTCTCCGGAACCATGGGCTCGTGTCTGTCGGAGAGAGCGTCGAGGAGGCCTTCTACTACATCCATAACCTCGTGGTTGCATGTGAGATCCAGGTTCGAACTCTGGCCAGCACAGGAGGGCCAGACAACTTAGTCCTCCTGGATCCTGGGAAGTACAAAGCCAAGTCCCGTTCCCCGGAGTCCCCGGCAGGGGAGGGCACCGGATCACCTCCCAAGTGGCTGATTGGTGAGCAGGAGTTTGAAGCCCTCATGCGGATGCTTGATAATCTGGGTTACAGGACTGGCTACCCTTACCGATACCCGGCTCTGAGAGAGAAGTCTAAAAAATGCAGCGACGCCGAGGTCCCTGCTGGTGTCGCAGGTCACTCCTTTGCTAGTGACGGCGATTCAGGCACTTGCTCCCCTCTCAGACACAGTTTTCAGAAGCAGCAACGCGAGAAGACAAGATGGCTGAACTCTGGCCGGGGCGACGATGCCTCTGAGGAAGGGCAGAATGGAAGCAGCCCCAAGTCGAAGACTAAGTGGACTAAAGAGGATGGACATAGAGCTTCCACCTCTGCTGTCCCTAACCTGTTTGTCCCATTGAACACGAACCCGAGAGAGGTCCAGGAGATGAGGAACAAGATCCGAGAGCAGAACTTGCAGGACATTAAGACGGCCGGGCCCCAGTCCCAGGTTTTGTGTGGTGTAGTGATGGACAGGAGCCTCGTCCAGGGGGAGCTGGTGACAGCCTCCAAGGCCATTATCGAGAAGGAGTACCAGCCCCACGTCATCGTGAGTACCGCAGGCCCCAACCCCTTCACCGCGCTGACGGACCGGGAGCTGGAGGAATACCGCAGGGAGGTGGAGCAGAAGCAGAGGGGCCCCGGAGAGAGTCTGGACGAGACGACGGAGCAGAGAGACGGCAGTCCGCCGGAGCCCCCTGCCGCTCCGCACACTCCCCCCAGCACCCCTGTTAAGCTGGAGGAAGACCTGCCGCAGGAGCCCGCTTCCGGAGACGACAGTGATGCCGCCACTTTCAAGCCAACTCTCCCCGACCTGTCCCCTGATGAGCCTTCAGAAGCGCTTGGCTTCCCAGCCCTGGAGAAGGAGGAGGAAGAGGGGCTTTGTGAAGCCCGTGGCCCTCCCGGCCCCACCAGGCCCCCCGCGGCGGCTAGCCCCGAGCCGGTCGCAGCCCAGGCGGCTGAAGAGGCTGCCTCCCCAGCGGCCGAGGACGGGGCTGCCGTGGATCCTGGCAGCGATGGGTCTCCAGGCAAGTCCCCGTCCAAGAAGAAGAAGAAGTTCCGCACCCCCTCCTTCCTGAAGAAGAGCAAGAAGAGGGGCGACTCCTGAAGGCCCGTCCCGCGCAGACCCATGCCACCGGACCGTCCCCGCCTGTGCCCCCCGCTGTCTTCTCGTGTAATGGAATGCAAAAAGCCCACCCCTCCGCATAGCTAGAGCCCCTTCCCGCCATGGCCAACGCCCACGCAGATGGGTGCTGACCTGCCCCCGGCCCTCAGCCTCAGGTCCCAGGGAGACCCAGCCCACGTCCACCTCCGTACTGTCTCACTGTTCCTCGGTGACGTGCTCTTGAGAGGCGTTCAGCCACGGTTCTGGCCAGACTGTCAGAGGCTCTGTGGTCTGGCCTTGACCCCTCTTGCTCTCCTGTCGTGCAGTGACCCATGCTGTCTGCTAGGCTCCCCTTCACCCCAAGGTCTCAGGTGACTGCTGAATCAGATGTGTAGCTTCCTGCCGGCGCTGTCTGCCCAGTGATCTCTCTTGGTTCACACACACAAGGCCTCAGTCCTGTGAAAACACCGTGTGCCTGCCAGCGGCCCAGGGCACCGTGGCGGCCTTTGGGAGGCGGGTCTGGGCCGAGCTGGAAACCCCAGCAGCGGACGGGCCTGTGTGCAGCCAATGCCACCTATGCATGGTCTAACCGGTTACCCCGCAGCCAGGAACGATTCAGGGCTCACAGCTCCTCACTCACTGGGGTCCTCAGGAAGGGAAGAGTCTTTTCTAGAATTTTCTTTCAGCACATGTGCGGTTCACCCCACACTTCTGTGAATACGAATGGCCACTTTTTGCTTTCGTTCTCTCTGGGGCCTGCTGCAGAGCAGCGGTCACCTGTTGTGGGGGAGGTTTCAGAACTGAGAGGGCTCTACTCCTACTGTAACTCAGCCCGAGCGACACCGTGGCTGCGGTCCAGGGCGGCTCAAGGCAGAAGTCGGCCCTAGGGGTCCCCACCTGACCCCGTGCCCCACGCCTGCCCTCCCTGCTCACACCAGTGTTCGCACTTAACTCAGATCCCCGGAAGGAGCGTCAGGCTGCTCAGTGGGAACTAGCGGGTGGCCACGGGGACTCCTCGAGGGTGACCCGTTGCAGGAGCTGCCCCGTGCCGACCTGACTAGGTGTGGGCAAGCCTGCCTGCTCCCCAGGCAGGCCCCCTGGGGACAGGCGGGGTCCTCGGTAGAGCTGGCACCTGACGGGGCTCGCGTCCCGCAGTCCGCACACCCGTGCGGGCCTCGAGGCTGGCCGCCGCTTCGAGCTCACGGCGAGCAAGCTGCTTTTCTCGTGTCGTTTTGTTGCCGAGGTGTGCTAAAGGCCCCATCGCGCCGTCCCTCAGTTAAGCACGGACTCTTCCGCTGTCACTTTCTTTGTCCCTCACACGCAGTGACTTTAATTTCACTTTTGTAGCGTAACCTCGTCACCACGTGCAGTGCAGTTGCGCGCGCAGACACGGGCCGGGAGGGCGAGCCCTGCGTCCTTCCTCCAGTGAACCGCGTTTTACTCACAAATAAAATTCTTTCAGCAGCTCCCTCGTCCGAACCTGGCGAGCACTTTCACGTGTTAATTCCTTTTCTTTGTTCCTTTAAAATCGGAC