Transcript asmbl_414391

Sequence
Transcript Sequence for observation asmbl_414391 of TGE0003118:
AAAGTGCTGGGATTACAGGCGTAGAATCATCTGTACGTGAGACTGGAAGTAAGCTCACTTTGAACTCTCCTTGAGGCCAGGGATGTTGTGTAGCTCATCTTTGTATTCCCAGCACCTAGCACAGAATAAGGCACACAAGAGGCGCTCAGCAAATATGGGAGGAGGAAGGGCGGAAAAAGGGGAGGGAGGAAATCGCCCTTAGGAGACACCCTCTTTCCGCGGCGGTTCCTCAACTCGGGACTTCTGACCTCCCACCAGCAGATGGCAAGAAAGAGTCCCGGCGCGCCAGCAAAGGGCTGAGCTGGGCGGAGCAGCTGAAAATCCGGCGCGCGCAGTCTCCAGCCCCAATTTCTACGCGCACCGGAAGACGGAGGTCCTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGGGTGGCAGCTCCAAAGCATTGGATGCTGGATAAATTGACCGGTGTGTTTGCTCCTCGTCCATCCACCGGTCCCCACAAGTTGAGAGAGTGTCTCCCCCTCATCATTTTCCTGAGGAACAGACTTAAGTATGCCCTGACAGGAGATGAAGTAAAGAAGATTTGCATGCAGCGGTTCATTAAAATCGATGGCAAGGTCCGAACTGATATAACCTACCCTGCTGGATTCATGGATGTCATCAGCATTGACAAGACGGGAGAGAATTTCCGTCTGATCTATGACACCAAGGGTCGCTTTGCTGTACATCGTATTACACCTGAGGAGGCCAAGTACAAGTTGTGCAAAGTGAGAAAGATCTTTGTGGGCACAAAAGGAATCCCTCATCTGGTGACTCATGATGCCCGCACCATCCGCTACCCCGATCCCCTCATCAAGGTGAATGATACCATTCAGATTGATTTGGAGACTGGCAAGATTACTGATTTCATCAAGTTCGACACTGGTAACCTGTGTATGGTGACTGGAGGTGCTAACCTAGGAAGAATTGGTGTGATCACCAACAGAGAGAGGCACCCTGGATCTTTTGACGTGGTTCACGTGAAAGATGCCAATGGCAACAGCTTTGCCACTCGACTTTCCAACATTTTTGTTATTGGCAAGGGCAACAAACCATGGATTTCTCTTCCCCGAGGAAAGGGTATCCGCCTCACCATTGCTGAAGAGAGAGACAAAAGACTGGCGGCCAAACAGAGCAGTGGGTGAAATGGGTCCCTGGGTGACATGTCAGATCTTTGTACGTAATTAAAAATATTGTGGCAG