Transcript asmbl_41070

Sequence
Transcript Sequence for observation asmbl_41070 of TGE0003057:
AGTCGATCCCGGAGCCCGGCCGCGGGGAGAGGTTCTCGGCAGAGAAGACAAAGCCCGCAGCAGCGATGGGGGGAGAGCTGGGCTCTGCGTGTTGTGGGGGCCAGGAAAGGGTGCCAGGCTGGGGCTGGAACCCCCTGGCAAAGGATGGGGTCCCCTCATCCCTAAACAGCAAGCCATCTCCCCTCGCCCGCCCCCCGCCCCCCCAGTCTCGGAGATCTCAGAGGCACCGACTGGGAGAGGAGGACCTATTAGAGCCTTTGCCCCGGCGTCGGTGACTCAGTGTTCGCGGGAGCGCCGCACCTACACCAGCCAACCCAGATCCCGAGGTCCGACAGCGCCCGGCCCAGATCCCCACGCCTGCCAGGAGCAAGCCGAGAGCCAGCCGGCCGGCGCACTCCGACTCCGAGCAGTCTCTGTCCTTCGACCCGAGCCCCGCGCCCTTTCCGGGACCCCTGCCCCGCGGGCAGCGCTGCCAACCTGCCGGCCATGGAGACCCCGTCCCAGCGGCGCGCCACCCGCAGCGGGGCGCAGGCCAGCTCCACTCCGCTGTCGCCCACCCGCATCACCCGGCTGCAGGAGAAGGAGGACCTGCAGGAGCTCAATGATCGCTTGGCGGTCTACATCGACCGTGTGCGCTCGCTGGAAACGGAGAACGCAGGGCTGCGCCTTCGCATCACCGAGTCTGAAGAGGTGGTCAGCCGCGAGGTGTCCGGCATCAAGGCCGCCTACGAGGCCGAGCTCGGGGATGCCCGCAAGACCCTTGACTCAGTAGCCAAGGAGCGCGCCCGCCTGCAGCTGGAGCTGAGCAAAGTGCGTGAGGAGTTTAAGGAGCTGAAAGCGCGCAATACCAAGAAGGAGGGTGACCTGATAGCTGCTCAGGCTCGGCTGAAGGACCTGGAGGCTCTGCTGAACTCCAAGGAGGCCGCACTGAGCACTGCTCTCAGTGAGAAGCGCACGCTGGAGGGCGAGCTGCATGATCTGCGGGGCCAGGTGGCCAAGCTTGAGGCAGCCCTAGGTGAGGCCAAGAAGCAACTTCAGGATGAGATGCTGCGGCGGGTGGATGCTGAGAACAGGCTGCAGACCATGAAGGAGGAACTGGACTTCCAGAAGAACATCTACAGTGAGGAGCTGCGTGAGACCAAGCGCCGTCATGAGACCCGACTGGTGGAGATTGACAATGGGAAGCAGCGTGAGTTTGAGAGCCGGCTGGCGGATGCGCTGCAGGAACTGCGGGCCCAGCATGAGGACCAGGTGGAGCAGTATAAGAAGGAGCTGGAGAAGACTTATTCTGCCAAGCTGGACAATGCCAGGCAGTCTGCTGAGAGGAACAGCAACCTGGTGGGGGCTGCCCACGAGGAGCTGCAGCAGTCGCGCATCCGCATCGACAGCCTCTCTGCCCAGCTCAGCCAGCTCCAGAAGCAGCTGGCAGCCAAGGAGGCGAAGCTTCGAGACCTGGAGGACTCACTGGCCCGTGAGCGGGACACCAGCCGGCGGCTGCTGGCGGAAAAGGAGCGGGAGATGGCCGAGATGCGGGCAAGGATGCAGCAGCAGCTGGACGAGTACCAGGAGCTTCTGGACATCAAGCTGGCCCTGGACATGGAGATCCACGCCTACCGCAAGCTCTTGGAGGGCGAGGAGGAGAGGCTACGCCTGTCCCCCAGCCCTACCTCGCAGCGCAGCCGTGGCCGTGCTTCCTCTCACTCATCCCAGACACAGGGTGGGGGCAGCGTCACCAAAAAGCGCAAACTGGAGTCCACTGAGAGCCGCAGCAGCTTCTCACAGCACGCACGCACTAGCGGGCGCGTGGCCGTGGAGGAGGTGGATGAGGAGGGCAAGTTTGTCCGGCTGCGCAACAAGTCCAATGAGGACCAGTCCATGGGCAATTGGCAGATCAAGCGCCAGAATGGAGATGATCCCTTGCTGACTTACCGGTTCCCACCAAAGTTCACCCTGAAGGCTGGGCAGGTGGTGACGATCTGGGCTGCAGGAGCTGGGGCCACCCACAGCCCCCCTACCGACCTGGTGTGGAAGGCACAGAACACCTGGGGCTGCGGGAACAGCCTGCGTACGGCTCTCATCAACTCCACTGGGGAAGAAGTGGCCATGCGCAAGCTGGTGCGCTCAGTGACTGTGGTTGAGGACGACGAGGATGAGGATGGAGATGACCTGCTCCATCACCACCACGTGAGTGGTAGCCGCCGCTGAGGCCGAGCCTGCACTGGGGCCACCCAGCCAGGCCTGGGGGCAGCCTCTCCCCAGCCTCCCCGTGCCAAAAATCTTTTCATTAAAGAATGTTTTGGAACTTTACTCGCTGGCCTGGCCTTTCTTCTCTCTCCTCCCTATACCTTGAACAGGGAACCCAGGTGTCTGGGTGCCCTACTCTGGTAAGGAAGGGAGTGGGAACTTTCTGATGCCATGGAATATTCCTGTGGGAGCAGTGGACAAGGGTCTGGATTTGTCTTCTGGGAAAGGGAGGGGAGGACAGACGTGGGGCATGCCCGCCCTGCCTCTCTCCCCCATTCTTGTTGCATGCATATCCTCTCATTTCCCTCATTTTTCCTGCAAGAATGTTCTCTCTCATTCCTGACCGCCCCTCCACTCCAATTAATAGTGCATGCCTGCTGCCCTACAAGCTTGCTCCCGTTCTCTCTTCTTTTCCTCTTAAGCTCAGAGTAGCTAGAACAGAGTCAGAGTCACTGCTCTGGTTCTCTGTCCCCAAGTCTTCCTGAGCCTTCTCCCCTTTTATGTCTTCCCTCTCCTCCTCCGGGCCCCTAGCCTCCCAAACCCCCATTGCCCGCTGGCTCCTTGGGCACAGAACCACACCTTCCTGCCTGGCGGCTGGGAGCCTGCAGGAGCCTGGAGCCTGGTTGGGCCTGAGTGGTCAGTCCCAGACTCGCCGTCCCGCCTGAGCCTTGTCTCCCTTCCCAGGGCTCCCACTGCAGCAGCTCGGGGGACCCCGCTGAGTACAACCTGCGCTCGCGCACCGTGCTGTGCGGGACCTGCGGGCAGCCTGCCGACAAGGCATCTGCCAGCGGCTCAGGAGCCCAGGTGGGCGGACCCATCTCCTCTGGCTCTTCTGCCTCCAGTGTCACGGTCACTCGCAGCTACCGCAGTGTGGGGGGCAGTGGGGGTGGCAGCTTCGGGGACAATCTGGTCACCCGCTCCTACCTCCTGGGCAACTCCAGCCCCCGAACCCAGAGCCCCCAGAACTGCAGCATCATGTAATCTGGGACCTGCCAGGCAGGGGTGGGGGTGGAGGCTTCCTGCGTCCTCCTCACCTCATGCCCACCCCCTGCCCTGCACGTCATGGGAGGGGGCTTGAAGCCAAAGAAAAATAACCCTTTGGTTTTTTTCTTCTGTATTTTTTTTTCTAAGAGAAGTTATTTTCTACAGTGGTTTTATACTGAAGG