Transcript asmbl_51205

Sequence
Transcript Sequence for observation asmbl_51205 of TGE0006098:
CATGAATGCAGTCCAAGTCCTGGGGGTGCCCGGGGGGCATCGTAGCGAAATTGCCTTGCTGGTCCATTGGGAGCGCGTCCAGAACCCCAGGCTTAGCTCTCTTTGCAACACCCAGCCAGGTCCCCACCGGGCACCTGGCCGCGCTCGGCTGTCCGGTCGCGGGCATGCTGCCTTGAGCCGCTGACCCCGCTGGAGACCCTGCATGCCAGCCTGGCCTGAAAACGGAGGACTCCACAGACCCGGTCCTCCCCACACCTCTTCTGCACAGAAGCAAACCCTCCTGACTTAGCCACGGCTTCCAGAACCTCTGAGACGGGAGGCCCCCAGGTTTACCTCATGTTTGGGGCATCTTGCTAGCTATGGCCCTGATCCTAGGCTTCTTGCTGCTGCTGGGGCTGGGCGGGAATACCATTTCAGAGGAGCCGCTGTCATCCAAAAGGACTACTTCTGATGTTCTGGAGTTTAAACTCCGGGAAGTGAAGTATGAGACCGAAGACTCTTATAAACTTGGACCCATTGGCATTCTCTTTCAAGTAGTGCACGTCTTTCTCCACGTGGTGCAGCCCAATGCTTTCCCCGAGGATATTCTCAAGAATGTATTACGAAACAAGTTTGACCTCTCAGCTGATTATAAGAAGATCATCCAGTATGAGCTGGGGATCATTATCTGCGCCGTCCTTGGCCTGCTCTTCATTATTCTGATGCCTCTGGTGGGGTTTTGCTTTGGTTTGTGTCGTTCCTGTAACAAGTGCGGTGGAGAAATGCACCAGCGACAGAAGAGAAACGGGACCTGTCTGAGGAAATACTTTGCAGTCTCTCTCTTGGTGATTTGTATGTTTATAAGCGTTGGTATCATCTATGGTTTTCTGGCAAACCACTACCTGAGGACCCATATCGAAAAGACTCAAAAACTGGTAGACAGCAACTTCAGAGACTTGAGAACTCTCCTGGACGAAACTCCAATGCAAATCGACTATGTACTGGACCAGTATAACACCACTAAGGAAAAGGCATTTTCAGATCTGGACAATGTTAAATCATTGCTGGGAGGCAGAATTCGCGATCAGCTAAGACCTAAAGTGATCCCTGTTCTTGATAACATCAAGGCCATGGTTGAAGTAATCAAAGAGACCAGAGAAGCCCTGTCGAACACGAACAATGCCTTAAAGGACCTGAAAAAATCAATTGCACAACTTGACACCAGCCTGAGTGACGTTAAAACGGACCTGGAGCAGGCACTCAGTGACCCCCTGTGCTCTATACCTCCAATAACCACCACTTGCAACGAGATCTCAATGACTCTAAACCAGCTGGATAACAACACTGACGTGGGAAAGATTCCCTTGTTGGATAATCAACTTGATAATGTTAATCATGTTCTTCAAACAGATTTGTCTAGCCTGGTCCAGAAGGGCTATCAAGCCTTTGATGACATACCTGAGATGGTGCAAAACCAAACCACGAACATAGTATTAGATATCAAAAGTACCTTGAATTCCATTGGTTTAGATATCAAACAAAAAAATGAACAGATTTCTATTCAGAATAAGCTGTCACGTTTCATGGATCCCATTAATTACGTTGAAAGTTATATCTACAACAAATTACGCAAGTTGAAAGAATATGACTCATACAGGTGGCTGAGCAGCTTGGTTATCTGCTGTTTCCTGACACTCGTCACGACTTTTTATTCCTTGGGCATATTATGTGGCATTTTTGGCTATGACCCGAATGCCTCCCCAACGAGAAGAGGTTGCATCTCCAACACCGGGGGCATCTTCCTCATGACTGGGGTTGGAATCAGTTTCCTCTTTTGTTGGCTATTGATGATCATTGTGGTTCTTACTTTTGTTATTGGCGGAAATGTGGAAAAATTGGTCTGCGAACCTTACCAGAACAGGAAGTTATTCCAGGTTTTGGACACACCGTATTTACTAAATGAGAATTGGAAATACTACCTCTCAGGCATAATATTTAACAAACCGGATATCAATCTTACTTTTGGACAAATATACAGCGATTGCAAAGAAAATAAAGGCATATATGCCACACTGAAGCTGGAAAACCGCTACAATATCAGTGAATATCTCAACGTTCAGGAGTACACCGAGAACATAAACAGTTATTTTGACAATCTCAACATAAAGATTGATAACATCGTTCTGCTGGACGACGCGGGAAGAAGAAGTCTCATGGATTTCGTTTCTTCAGGCGTAGATAGAATAAATTATGACGCTTACTTGGCTGAGACAACTAAAGCACCCACAAAAGTGAATCTTTTATTATTTGCAGATGTCCTACAAGAGAAAGCCAACCAATTGCCCCCAGGAAACTTGAGATCGTCCCTGATAAGAAACGAACAGATGATTAGAAGGATTTACCATGACCAAGTCATACCTCTGGAACTATCGATGAAAGGTATATACCGAAGCATCCAGGAGCTTCAATACAAAAGCAGTGGATTGGGGGCGAGTGTGAGCGATATCATTTCCTCTTTGGATTCAGCTCAGAAATTCATCGTCAAGAATATTTCCTCTATTATCATTAAGGCAAGTAAGAAGTATGGGAATACGATACTTGGATATTTTAAACTTTATCTGCAGTGGGTCAAGGTCTCAATCACTGAGCAAATCGCGGCCTGCAAACCTGTGGCCACCGCATTAGATTCTGCTGTGGACGTCTTTCTGTGCAACTACATTGTCGAACCCATGAATCTGTTTTGGTTCGGCATAGGAAAAGCGACCATATTTTTACTTCCAGCAATCATTTTTGCTGTAAAGCTGGCCAAGTACTATCGTCGAATGGATTCAGAAGATGTGTATGATGATGTTGAAACTGTCCCCATGAAAAAGTAAGCCTTTTCTTTTTTAAACCGTATTCATAAGCTCAGATGGGGGGGAGGCTCTTTATTATTATATGATGGACTTTTTAAATTAAGAACATCTTAAAATGAGGTAACGACAGTAGGCGTGCCCAGATTAAAATAAATGCTGATGTCTGTTGAAATAAGGACTGGTAAATAAGGACTGGGCGTTGAAGAAGTATTTGTCGAATTAATGAAAATTTTGTGTGTTAAATTTATGAATATACAAAAGGGTTGTTTTGAGATTTGATCTTTAAAGGGAGCAACATGTAAATATGCCCTTTGGCCTTTTTTTGTGTATTTGACAAGGCGTCAGATATTTTTCATGACTCTTACATTGTCTTTGTCATCCACGATATCGATACTTTGTCTTAGTAATAACATGGTGTTTGTGATGTATTTGTTTTTGTCACAGTATGCAAAAGGGTAATGTTGATTTTAATAGCCATCAAACCGCTCAGACTGTTCCAACAGAGTTTTTAAGCCCACCCGACTACCCGAGCTCTTCCTCTTCAGCGTCTCTAAATATTGAAAAAGAGACCAGCCCTCTAGGAGATGACAGACTTGGCGACACCGTCTAGGACACTCACCGATGGGTCCGAGAGGGAAAAGTGTACCCACCTATCTTCCATCTGTAGAAGTCTGGCTTGATCATCCGAGCCTTCTATGAAAGTTGAAACGTGTACCACGTTCACTAATTTTCAGCTTTGCCTTTGGAAGCAGAAATGAATTTTGTCACATTTCATTGCATGGGAACTTAGACTTGTAGTTAGAGAAAGTTCAGCAAGTAGCAGATATGTATATAAGCAATAAAAGAATGATTTCAGAAA