Transcript asmbl_394330

Sequence
Transcript Sequence for observation asmbl_394330 of TGE0002774:
GGGGTACATGGCTGCGGCGGGGGGGACCCGGGCCGCGCGGGTCGCGGGAGCCACACGCCCAGCCGCTCGGGGCGGGGCACTCGGGGGCGGGGCCGCACGGGTCCCTCCCCTTTGTCCCGCAGCTTGGCGGGCGCACGCGCGCTGACCTAGCCCGGCCCGGCCCCGCCCCGCGCCTGCGCGCTGGCCGCCTCGTGCGTCACTCGGCGCTTGCCGGCTGCCGGACCCGCCCCCACCGGCGACACCACTGGCCGCGAAGCGCAGGGGGGGCGCGCGCGCTGCCGCCCGTTCCCAGCACTTGTGCAGACTCCTCCGGGGAAGAGCGGCCTCCGCGGTCATCTCCAACGGAATTCTGCCTTTGAAGTGTCGGGGCACGGCGCGTCGAGGGTCCTGGCGGCCAGGCGGGGCGTGTGCAAGGGTCGCGTCCCCCCCCCGGGCCCCCGGCCCGTGGCTCTTGGTAGAGCCCAGTGCTTCATTTCCCGTGCGCGGCCCGGGCGGCCCTCCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTTGGCTGGCGTCAGAAAAATGGCTACAAACTTCCTAGCACATGAGAAGATCTGGTTCGACAAGTTCAAATATGACGACGCAGAAAGGAGATTCTACGAGCAGATGAACGGGCCTGTGGCAGGTGCCTCCCGCCAGGAGAACGGCGCCAGCGTGATCCTCCGTGACATTGCGAGAGCCAGAGAGAACATCCAGAAATCCCTGGCTGGAAGCTCAGGCCCCGGGGCCTCCAGCGGCACCAGCGGAGACCACGGTGAGCTCGTCGTCCGGATTGCCAGTCTGGAAGTGGAGAACCAGAGTCTGCGTGGCGTGGTACAGGAGCTGCAGCAGGCCATCTCCAAGCTGGAGGCCCGGCTGAACGTGCTGGAGAAGAGCTCGCCTGGCCACCGGGCCACGGCCCCACAGACCCAGCACGTATCTCCCATGCGCCAAGTGGAGCCCCCAGCCAAGAAGCCAGCCACACCAGCAGAGGATGACGAGGATGATGACATTGACCTGTTTGGCAGTGACAATGAGGAGGAGGACAAGGAGGCGGCACAGCTGCGGGAGGAGCGGCTACGGCAGTACGCGGAGAAGAAGGCCAAGAAGCCTGCACTGGTGGCCAAGTCCTCCATCCTGCTGGATGTCAAGCCTTGGGATGATGAGACGGACATGGCCCAGCTGGAGGCCTGTGTGCGCTCTATCCAGCTGGACGGGCTGGTCTGGGGGGCTTCCAAGCTGGTGCCCGTGGGCTACGGTATCCGGAAGCTACAGATTCAGTGTGTGGTGGAGGACGACAAGGTGGGGACAGACTTGCTGGAGGAGGAGATCACCAAGTTTGAGGAGCACGTGCAGAGTGTCGATATCGCAGCTTTCAACAAGATCTGAAGCCTGAGTGTGTGTACGTGCGCGCGTGCGTGAGGCCCTGCCACGATTAAAGACTGAGACCGGCCCTCTGGCTCCGTCCTGGTCATTTCCTGCTCGTACCTGGCCTGTCTCCCTCCCTGTCTCAGCCCCATCTCTGCCCTGCTGTTCCCACACAGTCATCCTGGCTGCTGCCACCCTCTGTGGCCATGTCACCTTGCCCCCAGCAGACCTCCGCCTGTCCCTCCATCTCCTGGCCACTCCCTCCCAAAGCTCTGGCCCTCCCTCTTCTTTCCATTGCAAAAGCAAGTCCAGTTCAGGGGGTTTAAAAAGCCAGAAACAGAAACTGTTAGGTCACTATCTGGAGAGGCCACCACCCCACCACTCTGCCTCCTGTTGGCATTGTCCCCATGGGAGCAAGCGTGCAAGCCTGGAATTGTCCAGGAAAGAAGTCCCAGTAGCACCCGGCCCTGCTGCCATGCCCTTTGTCATGTGCTGTCCCGGCCCTCCCCTCACCTCATTCATTCCTGGAATCCCTGCCCCTTGCTCCAGGGACTGTGCCCCTCCCATGATGTTCTGGGGTGGCCAGAACGTGGCTGCCTGGGCTCTGTGGAGCTGTGCCTCAGCATCCTGACAGCCGTATGTGGTCAGCATGGGTGGCCACACTCCCTCCCCTGGACCACCCGTGTTTGCATTGGGGTGAAAGAGGATGGGGTGTAATTACTTGATTACTTCTGGTCAGACTCTGTCCTCGGGGCCCCAAGCCACAGGGGAATGGATTCTCCCTGGGTAGTGGCCCCTGACTTTGCCCTCAAACCTTTAGAAAGTTTCCTGTGGGGCTTGGACTGCAGGACCCCATAAAAGCCACCACTGAGGGACACTGGGCCTTCATAGCCACAAAAGGTCTTTTGGTGCCAGCCGACAGTGGGCATGCGCCCCCCTGCCCCACGCCGCCCTTTCCTGGGTGCCAAGCTCTTTCCAAGCGACATTTGCGTCCATCTGGGCTGCCTCGTCCTAGCCTGGCTGCTCAAGCTCTAACTAAGGCAGCCTCTGGCCTCCCTCCCCAGGCCCAGGGCAGGAGCTGGCTGCTGGCCAGCGGTTGTCTTCTGGGTCGGTGGGGGTGGAGTCTGGCTGGTCTGTCCTCCACCCTTTCCGCCGCCTGGCAAGTCCTGAGCTGCACCTCATTGCCCGGCCAAAGGGCAGAGACACGAGCGACTGGGGGCACCTCTGGTGACCAAGACCGGGCTGCGCTCCAAAGAGGCCGTTGGGCCTGGAGTGGGGTTGGGGGGTCCGAGAGGAGTTGGGTGACATCCCCCACCCCATCCCGGGTCCAGCTGTTTCAGCCCCTCTCGGCGCGCCGATACTATTAGCCCCACCCGTCCTCCATCGAGTCCCGTGCCGCTCCCAAACGGCACGATAAGCCCCACAGGGAGTGCGCCATAGGCCGGGGCGCGTCACGGGGTCGGGGCGGGGCGGAGTCCGGACGTCGGGAGCAGGATGGCGGCGGAGCAGGACCCCGAGGCGCGCGCGGCGGCGCGGCCGCTGCTCACTGACCTCTACCAGGCCACCATGGCGTTGGGCTATTGGCGCGCGGGCCGGGCGCGGGACGCCGCCGAGTTCGAGCTCTTCTTCCGCCGCTGCCCGTTCGGCGGCGCCTTCGCCTTGGCCGCCGGCTTGCGCGACTGTGTGCGCTTCCTGCGCGCCTTCCGCCTGCGGGACGCCGGTAGTCCCCCGTCCGCGCGACGAGCCCCCCACGCCCGGCAGAAACCCCCACCTATGGCCGGTGGAAGTCCTTGTCCCCCCGTGGAACCCCCCATGTCCCACGACCGGTCTGTCCCCGCGCTGGTCTCAGCGCAGTTACCTCGTTTCCAGACGTGCAGTTCCTGGCCTCGGTGCTGCCCCCAGACACGGATCCTGCGTTCTTCGAGCACCTTCGGGCCCTCGACTGCTCCGAGGTGACGGTGCGAGCCCTGCCCGAGGGCTCCCTCGCCTTCCCCGGAGTGCCGCTCCTGCAGGTGTCCGGGCCGCTCCTGGTGGTGCAGCTGCTGGAGACACCGCTGCTCTGCCTGGTCAGCTACGCCAGCCTGGTGGCCACCAACGCAGCGCGGCTTCGCTTGATCGCAGGGCCAGAGAAGCGGCTGCTAGAGATGGGCCTGAGGCGGGCTCAGGGCCCCGATGGGGGCCTGACAGCCTCCACCTACAGCTACCTGGGCGATGTTGGCGCCAGCAGCTGGTGAGGGCCCTGGGGTGGACCTGGCGGCCAAAGCCCAGGTGTGGCTGGAGCAGGTGTGTGCCCACCTGGGGCTGGGGGTGCAGGAGCCGCATCCAGGCGAGCGGGCAGCCTTTGTGGCCTATGCCTTGGCTTTTCCCCGGGCCTTCCAGGGCCTCCTGGACACCTACAGCGTGTGGAGGTGAGCCCGGGCACTTTAGGGGTGGGCTCAGCAGAACCTCAGCAGCCTCTGACTCCCTTATCTATTTCTGCAGGAGTGGTCTCCCCAACTTCCTAGCAGTCGCCCTGGCCCTGGGAGAGCTGGGCTACCGGGCAGTGGGCGTGAGGCTGGACAGTGGTGACCTGCTACAGCAGGCTCAGGAGATCCGCAAGGTCTTCCGAGCTGCTGCAGCCCA