Transcript asmbl_394320

Sequence
Transcript Sequence for observation asmbl_394320 of TGE0002774:
GGGGTACATGGCTGCGGCGGGGGGGACCCGGGCCGCGCGGGTCGCGGGAGCCACACGCCCAGCCGCTCGGGGCGGGGCACTCGGGGGCGGGGCCGCACGGGTCCCTCCCCTTTGTCCCGCAGCTTGGCGGGCGCACGCGCGCTGACCTAGCCCGGCCCGGCCCCGCCCCGCGCCTGCGCGCTGGCCGCCTCGTGCGTCACTCGGCGCTTGCCGGCTGCCGGACCCGCCCCCACCGGCGACACCACTGGCCGCGAAGCGCAGGGGGGGCGCGCGCGCTGCCGCCCGTTCCCAGCACTTGTGCAGACTCCTCCGGGGAAGAGCGGCCTCCGCGGTCATCTCCAACGGAATTCTGCCTTTGAAGTGTCGGGGCACGGCGCGTCGAGGGTCCTGGCGGCCAGGCGGGGCGTGTGCAAGGGTCGCGTCCCCCCCCCGGGCCCCCGGCCCGTGGCTCTTGGTAGAGCCCAGTGCTTCATTTCCCGTGCGCGGCCCGGGCGGCCCTCCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTTGGCTGGCGTCAGAAAAATGGCTACAAACTTCCTAGCACATGAGAAGATCTGGTTCGACAAGTTCAAATATGACGACGCAGAAAGGAGATTCTACGAGCAGATGAACGGGCCTGTGGCAGGTGCCTCCCGCCAGGAGAACGGCGCCAGCGTGATCCTCCGTGACATTGCGAGAGCCAGAGAGAACATCCAGAAATCCCTGGCTGGAAGCTCAGGCCCCGGGGCCTCCAGCGGCACCAGCGGAGACCACGGTGAGCTCGTCGTCCGGATTGCCAGTCTGGAAGTGGAGAACCAGAGTCTGCGTGGCGTGGTACAGGAGCTGCAGCAGGCCATCTCCAAGCTGGAGGCCCGGCTGAACGTGCTGGAGAAGAGCTCGCCTGGCCACCGGGCCACGGCCCCACAGACCCAGCACGTATCTCCCATGCGCCAAGTGGAGCCCCCAGCCAAGAAGCCAGCCACACCAGCAGAGGATGACGAGGATGATGACATTGACCTGTTTGGCAGTGACAATGAGGAGGAGGACAAGGAGGCGGCACAGCTGCGGGAGGAGCGGCTACGGCAGTACGCGGAGAAGAAGGCCAAGAAGCCTGCACTGGTGGCCAAGTCCTCCATCCTGCTGGATGTCAAGCCTTGGGATGATGAGACGGACATGGCCCAGCTGGAGGCCTGTGTGCGCTCTATCCAGCTGGACGGGCTGGTCTGGGGGGCTTCCAAGCTGGTGCCCGTGGGCTACGGTATCCGGAAGCTACAGATTCAGTGTGTGGTGGAGGACGACAAGGTGGGGACAGACTTGCTGGAGGAGGAGATCACCAAGTTTGAGGAGCACGTGCAGAGTGTCGATATCGCAGCTTTCAACAAGATCTGAAGCCTGAGTGTGTGTACGTGCGCGCGTGCGTGAGGCCCTGCCACGATTAAAGACTGAGACCGGCCCTCTGGCTCCGTCCTGGTCATTTCCTGCTCGTACCTGGCCTGTCTCCCTCCCTGTCTCAGCCCCATCTCTGCCCTGCTGTTCCCACACAGTCATCCTGGCTGCTGCCACCCTCTGTGGCCATGTCACCTTGCCCCCAGCAGACCTCCGCCTGTCCCTCCATCTCCTGGCCACTCCCTCCCAAAGCTCTGGCCCTCCCTCTTCTTTCCATTGCAAAAGCAAGTCCAGTTCAGGGGGTTTAAAAAGCCAGAAACAGAAACTGTTAGGTCACTATCTGGAGAGGCCACCACCCCACCACTCTGCCTCCTGTTGGCATTGTCCCCATGGGAGCAAGCGTGCAAGCCTGGAATTGTCCAGGAAAGAAGTCCCAGTAGCACCCGGCCCTGCTGCCATGCCCTTTGTCATGTGCTGTCCCGGCCCTCCCCTCACCTCATTCATTCCTGGAATCCCTGCCCCTTGCTCCAGGGACTGTGCCCCTCCCATGATGTTCTGGGGTGGCCAGAACGTGGCTGCCTGGGCTCTGTGGAGCTGTGCCTCAGCATCCTGACAGCCGTATGTGGTCAGCATGGGTGGCCACACTCCCTCCCCTGGACCACCCGTGTTTGCATTGGGGTGAAAGAGGATGGGGTGTAATTACTTGATTACTTCTGGTCAGACTCTGTCCTCGGGGCCCCAAGCCACAGGGGAATGGATTCTCCCTGGGTAGTGGCCCCTGACTTTGCCCTCAAACCTTTAGAAAGTTTCCTGTGGGGCTTGGACTGCAGGACCCCATAAAAGCCACCACTGAGGGACACTGGGCCTTCATAGCCACAAAAGGTCTTTTGGTGCCAGCCGACAGTGGGCATGCGCCCCCCTGCCCCACGCCGCCCTTTCCTGGGTGCCAAGCTCTTTCCAAGCGACATTTGCGTCCATCTGGGCTGCCTCGTCCTAGCCTGGCTGCTCAAGCTCTAACTAAGGCAGCCTCTGGCCTCCCTCCCCAGGCCCAGGGCAGGAGCTGGCTGCTGGCCAGCGGTTGTCTTCTGGGTCGGTGGGGGTGGAGTCTGGCTGGTCTGTCCTCCACCCTTTCCGCCGCCTGGCAAGTCCTGAGCTGCACCTCATTGCCCGGCCAAAGGGCAGAGACACGAGCGACTGGGGGCACCTCTGGTGACCAAGACCGGGCTGCGCTCCAAAGAGGCCGTTGGGCCTGGAGTGGGGTTGGGGGGTCCGAGAGGAGTTGGGTGACATCCCCCACCCCATCCCGGGTCCAGCTGTTTCAGCCCCTCTCGGCGCGCCGATACTATTAGCCCCACCCGTCCTCCATCGAGTCCCGTGCCGCTCCCAAACGGCACGATAAGCCCCACAGGGAGTGCGCCATAGGCCGGGGCGCGTCACGGGGTCGGGGCGGGGCGGAGTCCGGACGTCGGGAGCAGGATGGCGGCGGAGCAGGACCCCGAGGCGCGCGCGGCGGCGCGGCCGCTGCTCACTGACCTCTACCAGGCCACCATGGCGTTGGGCTATTGGCGCGCGGGCCGGGCGCGGGACGCCGCCGAGTTCGAGCTCTTCTTCCGCCGCTGCCCGTTCGGCGGCGCCTTCGCCTTGGCCGCCGGCTTGCGCGACTGTGTGCGCTTCCTGCGCGCCTTCCGCCTGCGGGACGCCGGTAGTCCCCCGTCCGCGCGACGAGCCCCCCACGCCCGGCAGAAACCCCCACCTATGGCCGGTGGAAGTCCTTGTCCCCCCGTGGAACCCCCCATGTCCCACGACCGGTCTGTCCCCGCGCTGGTCTCAGCGCAGTTACCTCGTTTCCAGACGTGCAGTTCCTGGCCTCGGTGCTGCCCCCAGACACGGATCCTGCGTTCTTCGAGCACCTTCGGGCCCTCGACTGCTCCGAGGTGACGGTGCGAGCCCTGCCCGAGGGCTCCCTCGCCTTCCCCGGAGTGCCGCTCCTGCAGGTGTCCGGGCCGCTCCTGGTGGTGCAGCTGCTGGAGACACCGCTGCTCTGCCTGGTCAGCTACGCCAGCCTGGTGGCCACCAACGCAGCGCGGCTTCGCTTGATCGCAGGGCCAGAGAAGCGGCTGCTAGAGATGGGCCTGAGGCGGGCTCAGGGCCCCGATGGGGGCCTGACAGCCTCCACCTACAGCTACCTGGGCGGTGAGTGTCTGGTGCGGGGCAAGGCAAGGGCCGGGAAGGAGGAGCCCCATCTTGGCCCGAGGTCCCCCAATCCCACCGCCTTCCTCCCCAGGCTTCGACAGCAGCAGCAACGTGCTAGCGGGCCAGCTGCGAGGTGTGCCGGTGGCCGGGACCCTGGCCCACTCCTTCGTCACTTCCTTTTCAGGCAGCGAGGTGCCCCCTGACCCGATGTTGGCGCCAGCAGCTGGTGAGGGCCCTGGGGTGGACCTGGCGGCCAAAGCCCAGGTGTGGCTGGAGCAGGTGTGTGCCCACCTGGGGCTGGGGGTGCAGGAGCCGCATCCAGGCGAGCGGGCAGCCTTTGTGGCCTATGCCTTGGCTTTTCCCCGGGCCTTCCAGGGCCTCCTGGACACCTACAGCGTGTGGAGGAGTGGTCTCCCCAACTTCCTAGCAGTCGCCCTGGCCCTGGGAGAGCTGGGCTACCGGGCAGTGGGCGTGAGGCTGGACAGTGGTGACCTGCTACAGCAGGCTCAGGAGATCCGCAAGGTCTTCCGAGCTGCTGCAGCCCAGTTCCAGGTGCCCTGGCTGGAGTCAGTCCTCATCGTAGTCAGCAACAACATTGACGAGGAGGCGCTGGCCCGACTGGCCCAGGAGGGCAGTGAGGTGAATGTCATTGGCATTGGCACCAGTGTGGTCACCTGCCCCCAACAGCCTTCCCTGGGTGGCGTCTATAAGCTGGTGGCCGTGGGGGGCCAGCCACGAATGAAGCTGACCGAGGACCCCGAGAAGCAGACGTTGCCTGGGAGCAAGGCTGCTTTCCGGCTCCTGGGCTCTGAC