Transcript asmbl_50957

Sequence
Transcript Sequence for observation asmbl_50957 of TGE0006078:
CGCAGAGCCGCTGTAGTCTCGCGCGGCGGTTGCGAGCGCGTGAGGGACCTGTGCTGCGTTGCGTGCGGTTAGGCAGCAGCGGCAGCAGGAGCAGCAGCAGCTGTGTATAGGAGTCATGAAACACCACGAGGTGGAGATTCTGGACGCGAAGACACGGGAGAAGCTGTGCTTCTTGGACAAGGTGGAGCCCCATGCCACCATCGCCGAGATCAAGAATCTTTTCACTAAGAGCCATCCGCAGTGGTACCCTGCCCGCCAGTCCCTCCGTCTGGACCCTAAGGGCAAGTCCCTGAAGGATGAGGATATTCTGCAGAAGCTGCCTGTGGGTACCACGGCCACACTTTACTTCCGAGACCTGGGGGCCCAGATCAGCTGGGTGACGGTGTTCCTGACAGAGTACGCGGGGCCCCTTTTCATCTACCTGCTCTTCTACTTCCGGGTGCCCTTCATCTATGGCCACAAATATGACTTCACGTCCAGCCGGCACACGGTGGTGCACCTCGCTTGCATCTGCCACTCATTCCACTACATCAAGCGCCTTCTGGAGACACTCTTCGTGCATCGCTTCTCTCATGGCACCATGCCCTTGCGCAACATCTTCAAGAACTGCACCTACTACTGGGGCTTCGCTGCGTGGATGGCCTATTACATCAACCACCCTCTCTACACGCCCCCCACCTATGGAGCTCAGCAGGTTAAACTGGCACTTGCCATCTTTGTGATTTGTCAGCTGGGCAATTTCTCCATCCACATGGCCCTGCGGGACCTGCGGCCAGCAGGGTCCAAGACCAGGAAGATCCCCTACCCCACTAAGAACCCCTTCACATGGCTTTTCCTGCTGGTGTCCTGCCCCAACTACACCTATGAGGTGGGGTCCTGGATTGGCTTTGCCATCATGACACAGTGTCTCCCAGTGGCCCTCTTCTCCCTGGTGGGCTTCACCCAGATGACTATCTGGGCCAAGGGCAAGCACCGCAGCTACCTGAAGGAATTCCGAGACTACCCACCCCTGCGCATGCCCATCATCCCCTTCCTGCTCTGAGCTGCCCACCCCACTGGCTAGGCTCCGCCAGGCTTTCATCCCCCCACCCCTTGTCCTTTTGGGAGAGAAGTGAGGACCACTGCTCTTCAGCGCATGGAATAAAACCTGCCTGCATAGCCGGA