Transcript asmbl_394314

Sequence
Transcript Sequence for observation asmbl_394314 of TGE0002774:
GGGGTACATGGCTGCGGCGGGGGGGACCCGGGCCGCGCGGGTCGCGGGAGCCACACGCCCAGCCGCTCGGGGCGGGGCACTCGGGGGCGGGGCCGCACGGGTCCCTCCCCTTTGTCCCGCAGCTTGGCGGGCGCACGCGCGCTGACCTAGCCCGGCCCGGCCCCGCCCCGCGCCTGCGCGCTGGCCGCCTCGTGCGTCACTCGGCGCTTGCCGGCTGCCGGACCCGCCCCCACCGGCGACACCACTGGCCGCGAAGCGCAGGGGGGGCGCGCGCGCTGCCGCCCGTTCCCAGCACTTGTGCAGACTCCTCCGGGGAAGAGCGGCCTCCGCGGTCATCTCCAACGGAATTCTGCCTTTGAAGTGTCGGGGCACGGCGCGTCGAGGGTCCTGGCGGCCAGGCGGGGCGTGTGCAAGGGTCGCGTCCCCCCCCCGGGCCCCCGGCCCGTGGCTCTTGGTAGAGCCCAGTGCTTCATTTCCCGTGCGCGGCCCGGGCGGCCCTCCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTTGGCTGGCGTCAGAAAAATGGCTACAAACTTCCTAGCACATGAGAAGATCTGGTTCGACAAGTTCAAATATGACGACGCAGAAAGGAGATTCTACGAGCAGATGAACGGGCCTGTGGCAGGTGCCTCCCGCCAGGAGAACGGCGCCAGCGTGATCCTCCGTGACATTGCGAGAGCCAGAGAGAACATCCAGAAATCCCTGGCTGGAAGCTCAGGCCCCGGGGCCTCCAGCGGCACCAGCGGAGACCACGGTGAGCTCGTCGTCCGGATTGCCAGTCTGGAAGTGGAGAACCAGAGTCTGCGTGGCGTGGTACAGGAGCTGCAGCAGGCCATCTCCAAGCTGGAGGCCCGGCTGAACGTGCTGGAGAAGAGCTCGCCTGGCCACCGGGCCACGGCCCCACAGACCCAGCACGTATCTCCCATGCGCCAAGTGGAGCCCCCAGCCAAGAAGCCAGCCACACCAGCAGAGGATGACGAGGATGATGACATTGACCTGTTTGGCAGTGACAATGAGGAGGAGGACAAGGAGGCGGCACAGCTGCGGGAGGAGCGGCTACGGCAGTACGCGGAGAAGAAGGCCAAGAAGCCTGCACTGGTGGCCAAGTCCTCCATCCTGCTGGATGTCAAGCCTTGGGATGATGAGACGGACATGGCCCAGCTGGAGGCCTGTGTGCGCTCTATCCAGCTGGACGGGCTGGTCTGGGGGGCTTCCAAGCTGGTGCCCGTGGGCTACGGTATCCGGAAGCTACAGATTCAGTGTGTGGTGGAGGACGACAAGGTGGGGACAGACTTGCTGGAGGAGGAGATCACCAAGTTTGAGGAGCACGTGCAGAGTGTCGATATCGCAGCTTTCAACAAGATCTGAAGCCTGAGTGTGTGTACGTGCGCGCGTGCGTGAGGCCCTGCCACGATTAAAGACTGAGACCGGCCCTCTGGCTCCGTCCTGGTCATTTCCTGCTCGTACCTGGCCTGTCTCCCTCCCTGTCTCAGCCCCATCTCTGCCCTGCTGTTCCCACACAGTCATCCTGGCTGCTGCCACCCTCTGTGGCCATGTCACCTTGCCCCCAGCAGACCTCCGCCTGTCCCTCCATCTCCTGGCCACTCCCTCCCAAAGCTCTGGCCCTCCCTCTTCTTTCCATTGCAAAAGCAAGTCCAGTTCAGGGGGTTTAAAAAGCCAGAAACAGAAACTGTTAGGTCACTATCTGGAGAGGCCACCACCCCACCACTCTGCCTCCTGTTGGCATTGTCCCCATGGGAGCAAGCGTGCAAGCCTGGAATTGTCCAGGAAAGAAGTCCCAGTAGCACCCGGCCCTGCTGCCATGCCCTTTGTCATGTGCTGTCCCGGCCCTCCCCTCACCTCATTCATTCCTGGAATCCCTGCCCCTTGCTCCAGGGACTGTGCCCCTCCCATGATGTTCTGGGGTGGCCAGAACGTGGCTGCCTGGGCTCTGTGGAGCTGTGCCTCAGCATCCTGACAGCCGTATGTGGTCAGCATGGGTGGCCACACTCCCTCCCCTGGACCACCCGTGTTTGCATTGGGGTGAAAGAGGATGGGGTGTAATTACTTGATTACTTCTGGTCAGACTCTGTCCTCGGGGCCCCAAGCCACAGGGGAATGGATTCTCCCTGGGTAGTGGCCCCTGACTTTGCCCTCAAACCTTTAGAAAGTTTCCTGTGGGGCTTGGACTGCAGGACCCCATAAAAGCCACCACTGAGGGACACTGGGCCTTCATAGCCACAAAAGGTCTTTTGGTGCCAGCCGACAGTGGGCATGCGCCCCCCTGCCCCACGCCGCCCTTTCCTGGGTGCCAAGCTCTTTCCAAGCGACATTTGCGTCCATCTGGGCTGCCTCGTCCTAGCCTGGCTGCTCAAGCTCTAACTAAGGCAGCCTCTGGCCTCCCTCCCCAGGCCCAGGGCAGGAGCTGGCTGCTGGCCAGCGGTTGTCTTCTGGGTCGGTGGGGGTGGAGTCTGGCTGGTCTGTCCTCCACCCTTTCCGCCGCCTGGCAAGTCCTGAGCTGCACCTCATTGCCCGGCCAAAGGGCAGAGACACGAGCGACTGGGGGCACCTCTGGTGACCAAGACCGGGCTGCGCTCCAAAGAGGCCGTTGGGCCTGGAGTGGGGTTGGGGGGTCCGAGAGGAGTTGGGTGACATCCCCCACCCCATCCCGGGTCCAGCTGTTTCAGCCCCTCTCGGCGCGCCGATACTATTAGCCCCACCCGTCCTCCATCGAGTCCCGTGCCGCTCCCAAACGGCACGATAAGCCCCACAGGGAGTGCGCCATAGGCCGGGGCGCGTCACGGGGTCGGGGCGGGGCGGAGTCCGGACGTCGGGAGCAGGATGGCGGCGGAGCAGGACCCCGAGGCGCGCGCGGCGGCGCGGCCGCTGCTCACTGACCTCTACCAGGCCACCATGGCGTTGGGCTATTGGCGCGCGGGCCGGGCGCGGGACGCCGCCGAGTTCGAGCTCTTCTTCCGCCGCTGCCCGTTCGGCGGCGCCTTCGCCTTGGCCGCCGGCTTGCGCGACTGTGTGCGCTTCCTGCGCGCCTTCCGCCTGCGGGACGCCGACGTGCAGTTCCTGGCCTCGGTGCTGCCCCCAGACACGGATCCTGCGTTCTTCGAGCACCTTCGGGCCCTCGACTGCTCCGAGGTGACGGTGCGAGCCCTGCCCGAGGGCTCCCTCGCCTTCCCCGGAGTGCCGCTCCTGCAGGTGTCCGGGCCGCTCCTGGTGGTGCAGCTGCTGGAGACACCGCTGCTCTGCCTGGTCAGCTACGCCAGCCTGGTGGCCACCAACGCAGCGCGGCTTCGCTTGATCGCAGGGCCAGAGAAGCGGCTGCTAGAGATGGGCCTGAGGCGGGCTCAGGGCCCCGATGGGGGCCTGACAGCCTCCACCTACAGCTACCTGGGCGATGTTGGCGCCAGCAGCTGGTGAGGGCCCTGGGGTGGACCTGGCGGCCAAAGCCCAGGTGTGGCTGGAGCAGGTGTGTGCCCACCTGGGGCTGGGGGTGCAGGAGCCGCATCCAGGCGAGCGGGCAGCCTTTGTGGCCTATGCCTTGGCTTTTCCCCGGGCCTTCCAGGGCCTCCTGGACACCTACAGCGTGTGGAGGAGTGGTCTCCCCAACTTCCTAGCAGTCGCCCTGGCCCTGGGAGAGCTGGGCTACCGGGCAGTGGGCGTGAGGCTGGACAGTGGTGACCTGCTACAGCAGGCTCAGGAGATCCGCAAGGTCTTCCGAGCTGCTGCAGCCCAGTTCCAGGTGCCCTGGCTGGAGTCAGTCCTCATCGTAGTCAGCAACAACATTGACGAGGAGGCGCTGGCCCGACTGGCCCAGGAGGGCAGTGAGGTGAATGTCATTGGCATTGGCACCAGTGTGGTCACCTGCCCCCAACAGCCTTCCCTGGGTGGCGTCTATAAGCTGGTGGCCGTGGGGGGCCAGCCACGAATGAAGCTGACCGAGGACCCCGAGAAGCAGACGTTGCCTGGGAGCAAGGCTGCTTTCCGGCTCCTGGGCTCTGACGGTGAGGCCCTCCCATCCCCCCTGCTGTCCACCTTCAAAGCACCAGGGCCCCCGCTTATTCTTGCCCCGTCCACACAGGGTCTCCACTCATGGACATGCTGCAGTTAGCAGAAGAGCCAGTGCCACAGGCTGGGCAGGAGCTGAGGGTGTGGCCTCCAGGGGCCCAGGAGCCCTGCACCGTGAGGCCAGCCCAGGTGGAGCCACTACTGCGGCTCTGCCTCCAGCAGGGA