Transcript asmbl_394296

Sequence
Transcript Sequence for observation asmbl_394296 of TGE0002774:
GGGGTACATGGCTGCGGCGGGGGGGACCCGGGCCGCGCGGGTCGCGGGAGCCACACGCCCAGCCGCTCGGGGCGGGGCACTCGGGGGCGGGGCCGCACGGGTCCCTCCCCTTTGTCCCGCAGCTTGGCGGGCGCACGCGCGCTGACCTAGCCCGGCCCGGCCCCGCCCCGCGCCTGCGCGCTGGCCGCCTCGTGCGTCACTCGGCGCTTGCCGGCTGCCGGACCCGCCCCCACCGGCGACACCACTGGCCGCGAAGCGCAGGGGGGGCGCGCGCGCTGCCGCCCGTTCCCAGCACTTGTGCAGACTCCTCCGGGGAAGAGCGGCCTCCGCGGTCATCTCCAACGGAATTCTGCCTTTGAAGTGTCGGGGCACGGCGCGTCGAGGGTCCTGGCGGCCAGGCGGGGCGTGTGCAAGGGTCGCGTCCCCCCCCCGGGCCCCCGGCCCGTGGCTCTTGGTAGAGCCCAGTGCTTCATTTCCCGTGCGCGGCCCGGGCGGCCCTCCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTTGGCTGGCGTCAGAAAAATGGCTACAAACTTCCTAGCACATGAGAAGATCTGGTTCGACAAGTTCAAATATGACGACGCAGAAAGGAGATTCTACGAGCAGATGAACGGGCCTGTGGCAGGTGCCTCCCGCCAGGAGAACGGCGCCAGCGTGATCCTCCGTGACATTGCGAGAGCCAGAGAGAACATCCAGAAATCCCTGGCTGGAAGCTCAGGCCCCGGGGCCTCCAGCGGCACCAGCGGAGACCACGGTGAGCTCGTCGTCCGGATTGCCAGTCTGGAAGTGGAGAACCAGAGTCTGCGTGGCGTGGTACAGGAGCTGCAGCAGGCCATCTCCAAGCTGGAGGCCCGGCTGAACGTGCTGGAGAAGAGCTCGCCTGGCCACCGGGCCACGGCCCCACAGACCCAGCACGTATCTCCCATGCGCCAAGTGGAGCCCCCAGCCAAGAAGCCAGCCACACCAGCAGAGGATGACGAGGATGATGACATTGACCTGTTTGGCAGTGACAATGAGGAGGAGGACAAGGAGGCGGCACAGCTGCGGGAGGAGCGGCTACGGCAGTACGCGGAGAAGAAGGCCAAGAAGCCTGCACTGGTGGCCAAGTCCTCCATCCTGCTGGATGTCAAGCCTTGGGATGATGAGACGGACATGGCCCAGCTGGAGGCCTGTGTGCGCTCTATCCAGCTGGACGGGCTGGTCTGGGGGGCTTCCAAGCTGGTGCCCGTGGGCTACGGTATCCGGAAGCTACAGATTCAGTGTGTGGTGGAGGACGACAAGGTGGGGACAGACTTGCTGGAGGAGGAGATCACCAAGTTTGAGGAGCACGTGCAGAGTGTCGATATCGCAGCTTTCAACAAGATCTGAAGCCTGAGTGTGTGTACGTGCGCGCGTGCGTGAGGCCCTGCCACGATTAAAGACTGAGACCGGCCCTCTGGCTCCGTCCTGGTCATTTCCTGCTCGTACCTGGCCTGTCTCCCTCCCTGTCTCAGCCCCATCTCTGCCCTGCTGTTCCCACACAGTCATCCTGGCTGCTGCCACCCTCTGTGGCCATGTCACCTTGCCCCCAGCAGACCTCCGCCTGTCCCTCCATCTCCTGGCCACTCCCTCCCAAAGCTCTGGCCCTCCCTCTTCTTTCCATTGCAAAAGCAAGTCCAGTTCAGGGGGTTTAAAAAGCCAGAAACAGAAACTGTTAGGTCACTATCTGGAGAGGCCACCACCCCACCACTCTGCCTCCTGTTGGCATTGTCCCCATGGGAGCAAGCGTGCAAGCCTGGAATTGTCCAGGAAAGAAGTCCCAGTAGCACCCGGCCCTGCTGCCATGCCCTTTGTCATGTGCTGTCCCGGCCCTCCCCTCACCTCATTCATTCCTGGAATCCCTGCCCCTTGCTCCAGGGACTGTGCCCCTCCCATGATGTTCTGGGGTGGCCAGAACGTGGCTGCCTGGGCTCTGTGGAGCTGTGCCTCAGCATCCTGACAGCCGTATGTGGTCAGCATGGGTGGCCACACTCCCTCCCCTGGACCACCCGTGTTTGCATTGGGGTGAAAGAGGATGGGGTGTAATTACTTGATTACTTCTGGTCAGACTCTGTCCTCGGGGCCCCAAGCCACAGGGGAATGGATTCTCCCTGGGTAGTGGCCCCTGACTTTGCCCTCAAACCTTTAGAAAGTTTCCTGTGGGGCTTGGACTGCAGGACCCCATAAAAGCCACCACTGAGGGACACTGGGCCTTCATAGCCACAAAAGGTCTTTTGGTGCCAGCCGACAGTGGGCATGCGCCCCCCTGCCCCACGCCGCCCTTTCCTGGGTGCCAAGCTCTTTCCAAGCGACATTTGCGTCCATCTGGGCTGCCTCGTCCTAGCCTGGCTGCTCAAGCTCTAACTAAGGCAGCCTCTGGCCTCCCTCCCCAGGCCCAGGGCAGGAGCTGGCTGCTGGCCAGCGGTTGTCTTCTGGGTCGGTGGGGGTGGAGTCTGGCTGGTCTGTCCTCCACCCTTTCCGCCGCCTGGCAAGTCCTGAGCTGCACCTCATTGCCCGGCCAAAGGGCAGAGACACGAGCGACTGGGGGCACCTCTGGTGACCAAGACCGGGCTGCGCTCCAAAGAGGCCGTTGGGCCTGGAGTGGGGTTGGGGGGTCCGAGAGGAGTTGGGTGACATCCCCCACCCCATCCCGGGTCCAGCTGTTTCAGCCCCTCTCGGCGCGCCGATACTATTAGCCCCACCCGTCCTCCATCGAGTCCCGTGCCGCTCCCAAACGGCACGATAAGCCCCACAGGGAGTGCGCCATAGGCCGGGGCGCGTCACGGGGTCGGGGCGGGGCGGAGTCCGGACGTCGGGAGCAGGATGGCGGCGGAGCAGGACCCCGAGGCGCGCGCGGCGGCGCGGCCGCTGCTCACTGACCTCTACCAGGCCACCATGGCGTTGGGCTATTGGCGCGCGGGCCGGGCGCGGGACGCCGCCGAGTTCGAGCTCTTCTTCCGCCGCTGCCCGTTCGGCGGCGCCTTCGCCTTGGCCGCCGGCTTGCGCGACTGTGTGCGCTTCCTGCGCGCCTTCCGCCTGCGGGACGCCGACGTGCAGTTCCTGGCCTCGGTGCTGCCCCCAGACACGGATCCTGCGTTCTTCGAGCACCTTCGGGCCCTCGACTGCTCCGAGGTGACGGTGCGAGCCCTGCCCGAGGGCTCCCTCGCCTTCCCCGGAGTGCCGCTCCTGCAGGTGTCCGGGCCGCTCCTGGTGGTGCAGCTGCTGGAGACACCGCTGCTCTGCCTGGTCAGCTACGCCAGCCTGGTGGCCACCAACGCAGCGCGGCTTCGCTTGATCGCAGGGCCAGAGAAGCGGCTGCTAGAGATGGGCCTGAGGCGGGCTCAGGGCCCCGATGGGGGCCTGACAGCCTCCACCTACAGCTACCTGGGCGGTGAGTGTCTGGTGCGGGGCAAGGCAAGGGCCGGGAAGGAGGAGCCCCATCTTGGCCCGAGGTCCCCCAATCCCACCGCCTTCCTCCCCAGGCTTCGACAGCAGCAGCAACGTGCTAGCGGGCCAGCTGCGAGGTGTGCCGGTGGCCGGGACCCTGGCCCACTCCTTCGTCACTTCCTTTTCAGGCAGCGAGGTGCCCCCTGACCCGATGTTGGCGCCAGCAGCTGGTGAGGGCCCTGGGGTGGACCTGGCGGCCAAAGCCCAGGTGTGGCTGGAGCAGGTGTGTGCCCACCTGGGGCTGGGGGTGCAGGAGCCGCATCCAGGCGAGCGGGCAGCCTTTGTGGCCTATGCCTTGGCTTTTCCCCGGGCCTTCCAGGGCCTCCTGGACACCTACAGCGTGTGGAGGAGTGGTCTCCCCAACTTCCTAGCAGTCGCCCTGGCCCTGGGAGAGCTGGGCTACCGGGCAGTGGGCGTGAGGCTGGACAGTGGTGACCTGCTACAGCAGGCTCAGGAGATCCGCAAGGTCTTCCGAGCTGCTGCAGCCCAGTTCCAGGTGCCCTGGCTGGAGTCAGTCCTCATCGTAGTCAGCAACAACATTGACGAGGAGGCGCTGGCCCGACTGGCCCAGGAGGGCAGTGAGGTGAATGTCATTGGCATTGGCACCAGTGTGGTCACCTGCCCCCAACAGCCTTCCCTGGGTGGCGTCTATAAGCTGGTGGCCGTGGGGGGCCAGCCACGAATGAAGCTGACCGAGGACCCCGAGAAGCAGACGTTGCCTGGGAGCAAGGCTGCTTTCCGGCTCCTGGGCTCTGACGGGTCTCCACTCATGGACATGCTGCAGTTAGCAGAAGAGCCAGTGCCACAGGCTGGGCAGGAGCTGAGGGTGTGGCCTCCAGGGGCCCAGGAGCCCTGCACCGTGAGGCCAGCCCAGGTGGAGCCACTACTGCGGCTCTGCCTCCAGCAGGGACAGCTGTGTGAGCCGCTCCCATCCCTGGCAGAGTCTAGAGCCTTGGCCCAGCTGTCCCTGAGCCGACTCAGCCCTGAGCACAGGCGGCTGCGGAGCCCTGCACAGTAC