Transcript asmbl_394293

Sequence
Transcript Sequence for observation asmbl_394293 of TGE0002774:
GGGGTACATGGCTGCGGCGGGGGGGACCCGGGCCGCGCGGGTCGCGGGAGCCACACGCCCAGCCGCTCGGGGCGGGGCACTCGGGGGCGGGGCCGCACGGGTCCCTCCCCTTTGTCCCGCAGCTTGGCGGGCGCACGCGCGCTGACCTAGCCCGGCCCGGCCCCGCCCCGCGCCTGCGCGCTGGCCGCCTCGTGCGTCACTCGGCGCTTGCCGGCTGCCGGACCCGCCCCCACCGGCGACACCACTGGCCGCGAAGCGCAGGGGGGGCGCGCGCGCTGCCGCCCGTTCCCAGCACTTGTGCAGACTCCTCCGGGGAAGAGCGGCCTCCGCGGTCATCTCCAACGGAATTCTGCCTTTGAAGTGTCGGGGCACGGCGCGTCGAGGGTCCTGGCGGCCAGGCGGGGCGTGTGCAAGGGTCGCGTCCCCCCCCCGGGCCCCCGGCCCGTGGCTCTTGGTAGAGCCCAGTGCTTCATTTCCCGTGCGCGGCCCGGGCGGCCCTCCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTTGGCTGGCGTCAGAAAAATGGCTACAAACTTCCTAGCACATGAGAAGATCTGGTTCGACAAGTTCAAATATGACGACGCAGAAAGGAGATTCTACGAGCAGATGAACGGGCCTGTGGCAGGTGCCTCCCGCCAGGAGAACGGCGCCAGCGTGATCCTCCGTGACATTGCGAGAGCCAGAGAGAACATCCAGAAATCCCTGGCTGGAAGCTCAGGCCCCGGGGCCTCCAGCGGCACCAGCGGAGACCACGGTGAGCTCGTCGTCCGGATTGCCAGTCTGGAAGTGGAGAACCAGAGTCTGCGTGGCGTGGTACAGGAGCTGCAGCAGGCCATCTCCAAGCTGGAGGCCCGGCTGAACGTGCTGGAGAAGAGCTCGCCTGGCCACCGGGCCACGGCCCCACAGACCCAGCACGTATCTCCCATGCGCCAAGTGGAGCCCCCAGCCAAGAAGCCAGCCACACCAGCAGAGGATGACGAGGATGATGACATTGACCTGTTTGGCAGTGACAATGAGGAGGAGGACAAGGAGGCGGCACAGCTGCGGGAGGAGCGGCTACGGCAGTACGCGGAGAAGAAGGCCAAGAAGCCTGCACTGGTGGCCAAGTCCTCCATCCTGCTGGATGTCAAGCCTTGGGATGATGAGACGGACATGGCCCAGCTGGAGGCCTGTGTGCGCTCTATCCAGCTGGACGGGCTGGTCTGGGGGGCTTCCAAGCTGGTGCCCGTGGGCTACGGTATCCGGAAGCTACAGATTCAGTGTGTGGTGGAGGACGACAAGGTGGGGACAGACTTGCTGGAGGAGGAGATCACCAAGTTTGAGGAGCACGTGCAGAGTGTCGATATCGCAGCTTTCAACAAGATCTGAAGCCTGAGTGTGTGTACGTGCGCGCGTGCGTGAGGCCCTGCCACGATTAAAGACTGAGACCGGCCCTCTGGCTCCGTCCTGGTCATTTCCTGCTCGTACCTGGCCTGTCTCCCTCCCTGTCTCAGCCCCATCTCTGCCCTGCTGTTCCCACACAGTCATCCTGGCTGCTGCCACCCTCTGTGGCCATGTCACCTTGCCCCCAGCAGACCTCCGCCTGTCCCTCCATCTCCTGGCCACTCCCTCCCAAAGCTCTGGCCCTCCCTCTTCTTTCCATTGCAAAAGCAAGTCCAGTTCAGGGGGTTTAAAAAGCCAGAAACAGAAACTGTTAGGTCACTATCTGGAGAGGCCACCACCCCACCACTCTGCCTCCTGTTGGCATTGTCCCCATGGGAGCAAGCGTGCAAGCCTGGAATTGTCCAGGAAAGAAGTCCCAGTAGCACCCGGCCCTGCTGCCATGCCCTTTGTCATGTGCTGTCCCGGCCCTCCCCTCACCTCATTCATTCCTGGAATCCCTGCCCCTTGCTCCAGGGACTGTGCCCCTCCCATGATGTTCTGGGGTGGCCAGAACGTGGCTGCCTGGGCTCTGTGGAGCTGTGCCTCAGCATCCTGACAGCCGTATGTGGTCAGCATGGGTGGCCACACTCCCTCCCCTGGACCACCCGTGTTTGCATTGGGGTGAAAGAGGATGGGGTGTAATTACTTGATTACTTCTGGTCAGACTCTGTCCTCGGGGCCCCAAGCCACAGGGGAATGGATTCTCCCTGGGTAGTGGCCCCTGACTTTGCCCTCAAACCTTTAGAAAGTTTCCTGTGGGGCTTGGACTGCAGGACCCCATAAAAGCCACCACTGAGGGACACTGGGCCTTCATAGCCACAAAAGGTCTTTTGGTGCCAGCCGACAGTGGGCATGCGCCCCCCTGCCCCACGCCGCCCTTTCCTGGGTGCCAAGCTCTTTCCAAGCGACATTTGCGTCCATCTGGGCTGCCTCGTCCTAGCCTGGCTGCTCAAGCTCTAACTAAGGCAGCCTCTGGCCTCCCTCCCCAGGCCCAGGGCAGGAGCTGGCTGCTGGCCAGCGGTTGTCTTCTGGGTCGGTGGGGGTGGAGTCTGGCTGGTCTGTCCTCCACCCTTTCCGCCGCCTGGCAAGTCCTGAGCTGCACCTCATTGCCCGGCCAAAGGGCAGAGACACGAGCGACTGGGGGCACCTCTGGTGACCAAGACCGGGCTGCGCTCCAAAGAGGCCGTTGGGCCTGGAGTGGGGTTGGGGGGTCCGAGAGGAGTTGGGTGACATCCCCCACCCCATCCCGGGTCCAGCTGTTTCAGCCCCTCTCGGCGCGCCGATACTATTAGCCCCACCCGTCCTCCATCGAGTCCCGTGCCGCTCCCAAACGGCACGATAAGCCCCACAGGGAGTGCGCCATAGGCCGGGGCGCGTCACGGGGTCGGGGCGGGGCGGAGTCCGGACGTCGGGAGCAGGATGGCGGCGGAGCAGGACCCCGAGGCGCGCGCGGCGGCGCGGCCGCTGCTCACTGACCTCTACCAGGCCACCATGGCGTTGGGCTATTGGCGCGCGGGCCGGGCGCGGGACGCCGCCGAGTTCGAGCTCTTCTTCCGCCGCTGCCCGTTCGGCGGCGCCTTCGCCTTGGCCGCCGGCTTGCGCGACTGTGTGCGCTTCCTGCGCGCCTTCCGCCTGCGGGACGCCGACGTGCAGTTCCTGGCCTCGGTGCTGCCCCCAGACACGGATCCTGCGTTCTTCGAGCACCTTCGGGCCCTCGACTGCTCCGAGGTGACGGTGCGAGCCCTGCCCGAGGGCTCCCTCGCCTTCCCCGGAGTGCCGCTCCTGCAGGTGTCCGGGCCGCTCCTGGTGGTGCAGCTGCTGGAGACACCGCTGCTCTGCCTGGTCAGCTACGCCAGCCTGGTGGCCACCAACGCAGCGCGGCTTCGCTTGATCGCAGGGCCAGAGAAGCGGCTGCTAGAGATGGGCCTGAGGCGGGCTCAGGGCCCCGATGGGGGCCTGACAGCCTCCACCTACAGCTACCTGGGCGATGTTGGCGCCAGCAGCTGGTGAGGGCCCTGGGGTGGACCTGGCGGCCAAAGCCCAGGTGTGGCTGGAGCAGGTGTGTGCCCACCTGGGGCTGGGGGTGCAGGAGCCGCATCCAGGCGAGCGGGCAGCCTTTGTGGCCTATGCCTTGGCTTTTCCCCGGGCCTTCCAGGGCCTCCTGGACACCTACAGCGTGTGGAGGAGTGGTCTCCCCAACTTCCTAGCAGTCGCCCTGGCCCTGGGAGAGCTGGGCTACCGGGCAGTGGGCGTGAGGCTGGACAGTGGTGACCTGCTACAGCAGGCTCAGGAGATCCGCAAGGTCTTCCGAGCTGCTGCAGCCCAGTTCCAGGTGCCCTGGCTGGAGTCAGTCCTCATCGTAGTCAGCAACAACATTGACGAGGAGGCGCTGGCCCGACTGGCCCAGGAGGGCAGTGAGGTGAATGTCATTGGCATTGGCACCAGTGTGGTCACCTGCCCCCAACAGCCTTCCCTGGGTGGCGTCTATAAGCTGGTGGCCGTGGGGGGCCAGCCACGAATGAAGCTGACCGAGGACCCCGAGAAGCAGACGTTGCCTGGGAGCAAGGCTGCTTTCCGGCTCCTGGGCTCTGACGGGTCTCCACTCATGGACATGCTGCAGTTAGCAGAAGAGCCAGTGCCACAGGCTGGGCAGGAGCTGAGGGTGTGGCCTCCAGGGGCCCAGGAGCCCTGCACCGTGAGGCCAGCCCAGGTGGAGCCACTACTGCGGCTCTGCCTCCAGCAGGGACAGGTGGCTGCCCCACCGCCCTCATCCTGACCCCCAGCCCCGGTAGAGCCCTGACTGGGAGCTAGCCCCAAGCTTCTCTTTCCTTACCTCCTCCCTGCAGCTGTGTGAGCCGCTCCCATCCCTGGCAGAGTCTAGAGCCTTGGCCCAGCTGTCCCTGAGCCGACTCAGCCCTGAGCACAGGCGGCTGCGGAGCCCTGCACAGTAC