Transcript asmbl_50911

Sequence
Transcript Sequence for observation asmbl_50911 of TGE0006067:
CGGCGCGGCTGGGCGCTAAGATGGCGGCGGCGTGAGTTGCATGTTGTGTGAGGATCCCGGGGCCGCCGCGTCGCTCGGGCCCCGCCATGGCCGTCACCATCACACTCAAAACGCTGCAGCAGCAGACCTTTAAGATCCGCATGGAGCTTGACGAGACGGTGAAGGTGCTAAAGGAGAAGATAGAAGCTGAGAAGGGACGTGATGCCTTCCCCGTGGCTGGACAGAAACTCATTTATGCTGGCAAGATCCTGAGTGATGATGTCCCTATCAGGGACTATCGCATAGATGAGAAGAATTTTGTGGTTGTCATGGTGACCAAGGCTAAAACCAGCCCAGGCACATCAGTACCCCCAGAGGCTTCACCCACTGCTGCTCCAGAGTCCTCCACGTCCTTCTCGCCAGCCCCTGCTTCAGGCATGTCCCATTCCCCACCTACCGCCAGAGAAGACAAGAGCCCATCGGAGGAATCGGTCCCCACGACATCCCCGGAGTCTGTGTCAGGCTCTGTTCCTTCTTCAGGTAGCAGCGGGCGAGAGGAAGACGCGGCCTCCACACTAGTGACTGGCTCTGAGTATGAGACGATGCTGACGGAGATCATGTCCATGGGCTATGAGCGGGAACGGGTCGTGGCCGCCCTGAGAGCCAGCTACAACAACCCCCACCGAGCCGTGGAGTATCTGCTCACGGTGAGGTGGGGCTGCTGCCTCCTTGGGAGGCTTTCAAGGAATACCTGGGCTTCAGCACCCTGATGGGTGGTCAGGAAGACAAACCCTGCCCCCCGAAGCCTTTGGGTCATGGTACCAGCCAGGAAAGGCTTCTTGTAGGAGGCCAGACATGGGCAGAGAGGTGGGCCCGTGGAGGGCGGGGCTGACGTCTCACCTGTCTCCTGCCAGAGCTGAGTGTGCAGGAGGGAGGCAGCGGGTGGTCTGTGCATTAGAACTAAATAGGACCCCTGACAGGGAATTCCTGGGAGCCCCGAGC