Transcript asmbl_392780

Sequence
Transcript Sequence for observation asmbl_392780 of TGE0005515:
TCCTCGGCCCAGCCCCACAGCGCGCAGCTTCGGCAGGGTGGCTTTACGGCCGGAGGAGAGGGTGGGTCCCAGACCTGAGGTAGGAGGCCGAGCTGAGGGGCGGGGAAGAGGCTTTTTGCGGCAGGACGTAAGTGACGGCGAAGGCGGTGCGACAGCAGCTGGAGGGCAGAGGAGGCGGCGCGGGGTGTCCTGTCCTCGCCATGAGGCCGCAGCAGGCGCCGGTGTCCGGAAAGGTGTTCATTCAGCGAGACTACAGCAGTGGCACACGCTGCCAGTTCCAGACCAAGTTCCCTGCGGAGCTGGAGAACCGGATTGATAGGCAGCAGTTTGAAGAAACAGTTCGAACTCTAAATAACCTTTATGCAGAAGCAGAGAAGCTCGGCGGCCAGTCATATCTCGAAGGTTGTTTGGCTTGTTTAACAGCATATACCATCTTCCTATGCATGGAAACTCATTATGAGAAGGTTCTGAAGAAAGTCTCCAAATACATTCAAGAGCAGAATGAGAAGATCTATGCTCCACAAGGCCTCCTCCTGACAGACCCTATTGAGCGAGGACTGCGAGTTATTGAAATTACCATTTATGAAGACAGAGGCATGAGCAGTGGAAGATAAACCGAAGAATTAAAGATCCCACTTCCAGCCGGGCCCCTCATGTATCCACTGGCCGACCGCAGAGTGTCCCTACCTCCTCTCCAGAGCATCATTCCTTTCTATCTGCTGCCAGAGCCACGGTGCCATTTACTCCAAGGACTCACTTTCTAAAATTCCACACCTGGAGTGACCTCTAGTCGCTCAGCATCCACTTTGTGTCTCCAAATTGTGTAGGACTCTGTAATCTTTTGATTAGTTTCTGAGAAAACACAATGAAGCACTTCACTTTTTTTTATTCAAAGCCATTTAATAAAACACAGTTGGTCAGCCCAGTGCAAAGCTTGTTATCTGCCACCAGTACATACCATTGGTTCTCTTCATTCCTTGGGCCAGCTTCTCAGGTGGCTTTAGACCTCAACAAGCCGTATCTTCACCAGTGTTCTATCTTGTTCCCCTAAATTAATAAAATGTTTTTCTCCAGGATTTTGGTGAGGGTTGGCTGTGGCTGTCGTTTTGCACCTCCCAGATTTCAAAGAATTACTGGTTTTACCATGACTCAAATCTTAAGATCTGTTTCTACTATTCAGTTCCTCAAACTGAAGCTTATTGAAAAAAAAATGTATAATGTTATTTGTTTTATTATAGCAATTATGCCTAATTAAAGCAGTATTTAATGCAATTTCCAGTTATTTCTTTGGAGAATTTTATGTCATTGTTCCATTACCTTGAATGTTGGAAAGATATGATACGTGCTGCTTGTTCATCACAAAAATCAGTAAGCACAATAAAGTGGATGCCAAACCATCAGACACATAAATGTTCCCGCTGTGTCCCTGGATATGGAATAAGCAGGTATAAAAAATATTTTAATTATAGTTTTGTTATAAATATAACTTATGAGAAAAAAATTTGATAGGAATAATACTGTATATTACTAATTTTTAACTATCCCTAAGGCAAACCTTATGACCCACAGAATTTTCTCATATACAGTATTCAGTGCACAGAAATCTTATGATTGGCTCAAGTACAGTAAGTTACTTCTCAGTAAAACTCTCAAGTCTGAGTCCATATTTGTAGCTCTGCTTTTGGCTGTACGTTCCTAGGATCGGGGCTGCTTATGCCTTTCGTTTATCCTTGGGGTTTGAGAGCGCTGTATTTGGGAGAGAGTTTAAAAATACATTAGGAGAGAGAAACCATTAAAAGTTTCACTGTCAGATATATTGTAGGTGCTAATACTGGATTTCGTCTCAGATTTAATTTCTTTTATGGGTCTGTTAGTCATTCAACAAATCCCATAAGTATGTGTTAATATTTTAATTGTGTAAAACTCATTTGTTACTTTACAGCCTGTAATAGTGTGTCTGCATTTTCAACCTGTTGCAATAACTTTGCTGAAATATTAACACATTAATAAAACTTTTCTT