Transcript asmbl_50908

Sequence
Transcript Sequence for observation asmbl_50908 of TGE0010001:
GTCCCTGCTGCAGAGCTGCTGTCTGAGGATCTTCTTAAAGGGCCCGCGCGCCGCCGCCCCCTCGGCCCGCCATGCTGCTACCCGTACCGCTGCTGCTCGGCCTTCTTGGCCTGGCTGCCGCCGAACCCGTCGTCTACTTCAAGGAACAGTTTCTGGACGGAGATGGGTGGACTAACCGCTGGATTGAATCCAAACACAAGTCGGATTTTGGAAAATTTGTTCTCAGTGCCGGCAAGTTCTACGGTGACTTGGACAAAGATAAAGGGCTGCAGACAAGCCAGGATGCCCGCTTCTACGCCCTGTCGGCCAGATTCGAGCCGTTCAGCAACAAGGACCAGACGTTGGTGGTGCAGTTCACGGTGAAACACGAGCAGAACATTGACTGTGGGGGTGGATACGTGAAGCTATTTCCAGATGGTTTGGACCAGACGGATATGCACGGAGACTCCGAGTACAACATCATGTTTGGTGAGGGGCTCCACCCTGGTGCTGACTTTCAATTAGAGGCAGGCTGAGG