Transcript asmbl_38515

Sequence
Transcript Sequence for observation asmbl_38515 of TGE0002492:
CCCTGTTCCTCCCACTTCCGCGGGCACCCAACTGTGCGTCTCCTGCGCGCTGACGTCAGGTGCGTGCCCCTGTCCGGCAGCCGAGGAGACCCCGCGCAGTGCTGCCAACGCCCCGGTGGAGAAGCTGAGGTCATCATCAGATTTGAAATATTTAAAGTGGATACAAAACTATTTCAGCAATGCAGACAATTAAGTGTGTTGTTGTGGGCGATGGTGCTGTTGGTAAAACATGTCTCCTGATATCCTACACAACAAACAAATTTCCATCGGAATATGTACCGACTGTTTTTGACAACTATGCAGTCACAGTTATGATTGGTGGAGAACCATATACTCTTGGACTTTTTGATACTGCAGGGCAAGAGGATTATGACAGATTACGACCGCTGAGTTATCCACAAACAGATGTATTTCTAGTCTGTTTTTCAGTGGTCTCTCCATCTTCATTTGAAAACGTGAAAGAAAAGTGGGTGCCTGAGATAACTCACCACTGTCCAAAGACTCCTTTCTTGCTTGTTGGGACTCAAATTGATCTCAGAGATGACCCCTCTACTATTGAGAAACTTGCCAAGAACAAACAGAAGCCTATCACTCCAGAGACTGCTGAAAAGCTGGCCCGTGACCTGAAGGCTGTCAAGTATGTGGAGTGTTCTGCACTTACACAGAAAGGCCTAAAGAATGTATTTGACGAAGCAATATTGGCTGCCCTGGAGCCTCCAGAACCGAAGAAGAGCCGCAGGTGTGTGCTGCTATGAACATCTCTCCAGAGCCCTTTCTGCACAGCTGGTGTCGGCATCATACTAAAAGCAATGTTTAAATCAAACTAAAGATTAAAAATTAAAATTCGTTTTTGCAATAATGACAAATGCCCTGCACCTACCCACATGCACTCGTGTGAGACAAGGCCCATAGGTATGGCCCCCCCCTTCCCCCTCCCAGTACTAGTTAATTTTGAGTAATTGTATTGTCAGAAAAGTGATTAGTACTATTTTTTTTTGTTGTTTC