Transcript asmbl_50871

Sequence
Transcript Sequence for observation asmbl_50871 of TGE0006056:
GTGAAAGAGTTCTTAGCCAAAGCCAAAGAAGATTTTCTTAAAAAATGGGAAAATCCTGCTCAGAATACAGCCCATTTGGATCAGTTTGAACGAATCAAGACCCTCGGCACAGGCTCCTTCGGGCGGGTGATGCTAGTAAAACACAAGGAGACCGGGAGCCACTTCGCCATGAAGATCCTGGACAAACAGAAGGTGGTAAAGCTGAAACAGATCGAGCACACCCTGAACGAGAAGCGCATCCTGCAGGCAGTCAACTTTCCGTTCCTCGTTAGACTCGAGTTCTCCTTCAAGGACAACTCAAATTTATACATGATCATGGAGTATGTGCCTGGCGGGGAAATGTTCTCACACCTGCGGCGGATCGGAAGGTTCAGCGAGCCCCATGCCCGCTTCTACGCCGCCCAGATCGTCCTGACCTTCGAGTACCTGCACTCCCTTGATCTCATCTACCGGGACCTGAAGCCGGAGAACCTTCTCATCGACCAGCAGGGCTACATTCAGGTTACAGACTTTGGTTTTGCCAAGCGTGTGAAAGGCCGCACCTGGACCTTGTGTGGGACCCCTGAGTACCTGGCCCCTGAGATCATACTGAGCAAAGGCTACAACAAGGCTGTGGACTGGTGGGCACTGGGGGTTCTCATCTATGAGATGGCCGCCGGCTACCCACCCTTCTTCGCTGACCAGCCCATCCAGATCTATGAGAAGATTGTCTCTGGGAAGGTGCGGTTCCCGTCTCACTTCAGCTCTGACCTGAAGGATCTGCTGCGGAACCTACTGCAGGTGGACCTCACCAAGCGCTTTGGGAACCTCAAGAATGGGGTCAATGACATCAAGAACCACAAGTGGTTTGCCACAACTGACTGGATCGCCATCTACCAGAGGAAGGTGGAAGCTCCCTTCATACCAAAGTTTAAAGGCCCTGGGGACACGAGTAACTTTGACGACTATGAGGAGGAAGAGATTCGAGTCTCCATCAATGAGAAGTGTGGCAAGGAGTTTTCTGAGTTTTAGGGGTGTGCCTGTGCCCCCAAGGGTTTTTTCTTTTTTTGTGTGGGGGGGGTG