Transcript asmbl_379998

Sequence
Transcript Sequence for observation asmbl_379998 of TGE0002767:
CGGACAGGTCCGCGGCGCCCTCACTTCCTGGCATTCCCTCCTCCCCCTCCCCGTCGTTACCCTGTACATCCGGGTCACTTGCCCTCCCCGCTCGGAGCTGCCGCCTGGCTTGTCGCGGCTCTGCCACAGGGGCAGGTGTTGAGGGGCTCCCGGTCCGGCTGCCGCCGCTCCCCCGCTCCGGACCCGGGGCTCCCCCTAGCGCCGCTGAGGAGCCGCCTCTGCGGCTCCAGGAGGGCGCAGGAGCGGGACTGAGAGCGCCTGGAGGCTCGAGCGGAGGGTAATTCATTTGCACACCTGTTAGCAAGAAACAGAAGTTGAAGGACTGGAACAAGTGAACTAGGAAAGAGGGAACGCCAATCCAAGGATAGAAGGACAAGGACAGAATCACCAGCACTGGCTGAAGGTACCTTAACATGGGGAATCTTCTTAAAGTTTTGACATGCACAGACCTTGAGCAGGGGCCAAATTTTTTCCTTGATTTTGAAAATGCCCAGCCTACAGAGTCTGAGAAGGAAATTTATAATCAGGTGAATGTAGTATTAAAAGATGCAGAAGGCATCTTGGAGGACTTGCAGTCATACAGAGGAGCTGGCCACGAAATACGAGAGGCAATCCAGCATCCAGCAGATGAGAAGTTGCAAGAGAAGGCATGGGGTGCAGTTGTTCCACTAGTAGGCAAATTAAAGAAATTTTACGAATTTTCTCAGAGGTTAGAAGCAGCATTAAGAGGTCTTCTGGGAGCCTTAACAAGTACCCCATATTCTCCCACCCAGCATCTAGAGCGAGAGCAGGCTCTTGCTAAACAGTTTGCAGAAATTCTTCATTTCACACTCCGGTTTGATGAACTCAAGATGACAAATCCTGCCATACAGAATGATTTCAGCTATTATAGAAGAACATTGAGTCGTATGAGGATTAACAATGTACCGGCAGAAGGAGAAAATGAAGTAAATAATGAATTGGCAAATCGAATGTCTTTGTTTTATGCTGAGGCAACTCCAATGCTGAAAACCTTGAGTGATGCCACAACAAAATTTGTATCAGAGAATAAAAATTTACCAATAGAAAATACCACAGATTGTTTAAGCACAATGGCTAGTGTATGCAGAGTCATGCTGGAAACACCGGAATACAGAAGCAGATTTACAAATGAAGAGACAGTGTCATTCTGCTTGAGGGTAATGGTGGGTGTCATAATACTCTATGACCACGTACATCCAGTGGGAGCATTTGCTAAAACTTCCAAAATTGATATGAAAGGTTGTATCAAAGTTCTTAAGGACCAACCTCCTAATAGTGTGGAAGGTCTTCTAAATGCTCTCAGGTACACAACAAAACATTTGAATGATGAGACTACCTCCAAGCAAATTAAATCCATGCTGCAATAACAATTCTGGAATAAGCACCTGCTGTAGACAGAAGACAGTATTCTGCAATGACTGAGAATGCAGTTTTTTAGTGATTGCAATTACTATCTCATTTATTCTTGCTTTTATTTCTTTCCTCTGTTCCTCTTCCCTCTTTTTTAATCATGTTCTTAAGACTTCTTTTCTGTGCCAAAATCAGTAAAGTTACACTCTGAAGGGATATCATCCTTTCAAACGGGCCATCTAAGGCAGCTAATTATGCATTGCATTGGGGTCTCTACTGAGAAAAATTCTGTGACTTGAACTAAATATTTTTAAATGTGGATTTTTTTTGAAACTAATATTTAATATTGCTTCTCCTGCATGGCAAAACTGCCTATTCTGCTATTTAAAAACCCTCAATGACTTTATTTTCTACTGCCGCCTTTTTCATGTGCAACCAAAATGAAAATGTTTAAATTAACTGTGTTGTACAAATGGTACCCAACACAAACTTTTTTTAAATTAGTAATACTTTTGTTTAAAGTTTTAAGTTTGCATTTTGACTTTTTTTGTAAGGATGTATGTTGTGTGTTTAACCTTTATTAACTAACGTTAAAAGCTGTGATGTGTGCGTAGAATATTACGTATGCATGTTCATGTCTAAAGAATGGCTGTTGATGATAAAATAAAAATCAGCTTTCATTTTTCTAAGTGTGGCTTGGTTTACTGATGTTTTGTTTTTAGGCTTCTGAAGTTTTCCCCATGTATGTTTTTATGGAATGCATATATACATTACATGATTTTTTCTTCTTTTAGGGGAGAGCCGGGTCTTTTCATTAGAATTTTGATCATTGTCTATGTATATACTTTTAATTGCCTTTAAAATTTTGCTAAGTATATTAAGACCAGTGATCTTTTCATTAACTGGACTTTTATTCTTGATTTACTCTTGTATGGATGTAGTAATGGAAGGAAAACCGCATCCTTGCTTGATTCTCCATTTCCAGGGGAGCGGGTAGCAACATGAAGGCAGAGTAGCCCTTTAATCATGGGAAGAGAGTGATTATAAGAGGGACTTCCCAGGAGAAAAGCAGAGGCCATGATCTCACTAGTGGTAGAAAACTAACAGGTTTCAGTTTAAGATCATAAAACCTAAATCATGAAATCTAAATCTCATGGTTGGAACAAACTACTTAAAGGTTGTCTAGTTCAACCATGCCAGTGTTTTAAATATTTAGGAATATCCGAGGTATAATACAATTAAAATGTTTAACCATGGAAGAGAATCACAGAGGCTTCCATCAGACCCTTCTGGATTAATAGGGCCAGATCATGGCACACACAGCTTCTCAAGATCACATCCCTGCTGATCTCTCTGGCCCTCCTGATCACTGCTCCCCCACTTCACACCCTGTCCTGCAGCCAGGCCCTACTGCTTGCTGTTCACAAATTGTTCCATGTGATGTCACTTCCTTAGCTCTGGTCTGGCTGGTCCCTGAACCTGACATTCCCTTCCTCCCCTTGTGACCCTCTAATGAACGCCAACTTTCATCTTTGAAGGGTTAGCTTCTATTACCTCCTTCATGAAGCCTTCTGGATAACATTGGCCATATCCTTCTAGGCATCTTCTAAGAATAGTGTAATAGGCTGAATAGTGGCCCCCAGGAGATACATTCACTGGGAATCTCCACGTGTGACATTATTTGGAAAAAGTTTTTGCAGATGAAATCAAGGACCTGGAAATGAGATCAACCTGTAGTAGGGTGGGCCCTAAATTCAATGACTAGCTCTTAGAAAAGAAGGGGAAATAGACACACAGAGCTGAAGGCCATGGGAAGATGGAGGCAGAGATTAGAGCAATGCATCTATGAGCCAAAGAACCCTAAGAATTGGAGGAAGTCACTAGAAGCTAGGAAAACAGGCATGTCACAGATTCTCCCTCAGAGTCTCGAGAAGGAACCAACCCTACCAATATCTTGATTTCAGACATCTGGCCTCCAGGATTGTGAGGGAATAAATTTCTGTTGTTTTAAGCCATGCAGTTTGTGGTATTTTGGTACAGCAGCCTTAAGAATCTGATACATGTATCTCGTAAAACACCTCTGATACTTACCTGCGCTTGTGGCTGTGTTTTCTGATACTATGAGAGCCGTAGTATCTGGATACCGGAGAGTCTGCGAACTTGAGAGAAGGGCCGTGTCTGATTTTCCTTCAGTGTCCCAAGGAAGGATCTTGCACAGTACCCAGATTTGGAGAGGTGCCAAGTGAATGCTTCGGTGGACTGAATGAATACAAATCAAAAATAATGATGCAGCGGGAATGGATGCAGTAAGATTGCTGTGGCCTATGCAGTTCACACAGTTCACACTCTGCATGTTGAGGAGTAAGTGGACAGATCTCTTAAGCCCAGGGGCTAGCAAACCGGTCTGTGGGCCAATTTACTCACCGTCTGTTTTTGTACAGCTTGTGAGCTAAAAATGGTTTTTAAAAAGGTTGAATACAATCAAAAGAATAATATTTTGTGGCATGAGAAAAGCATATGAAATTCAAATTTTAGTGTTCATAAATAAAATTTTATTGGAACC