Transcript asmbl_379997

Sequence
Transcript Sequence for observation asmbl_379997 of TGE0002767:
CGGACAGGTCCGCGGCGCCCTCACTTCCTGGCATTCCCTCCTCCCCCTCCCCGTCGTTACCCTGTACATCCGGGTCACTTGCCCTCCCCGCTCGGAGCTGCCGCCTGGCTTGTCGCGGCTCTGCCACAGGGGCAGGTGTTGAGGGGCTCCCGGTCCGGCTGCCGCCGCTCCCCCGCTCCGGACCCGGGGCTCCCCCTAGCGCCGCTGAGGAGCCGCCTCTGCGGCTCCAGGAGGGCGCAGGAGCGGGACTGAGAGCGCCTGGAGGCTCGAGCGGAGGATAGAAGGACAAGGACAGAATCACCAGCACTGGCTGAAGGTACCTTAACATGGGGAATCTTCTTAAAGTTTTGACATGCACAGACCTTGAGCAGGGGCCAAATTTTTTCCTTGATTTTGAAAATGCCCAGCCTACAGAGTCTGAGAAGGAAATTTATAATCAGGTGAATGTAGTATTAAAAGATGCAGAAGGCATCTTGGAGGACTTGCAGTCATACAGAGGAGCTGGCCACGAAATACGAGAGGCAATCCAGCATCCAGCAGATGAGAAGTTGCAAGAGAAGGCATGGGGTGCAGTTGTTCCACTAGTAGGCAAATTAAAGAAATTTTACGAATTTTCTCAGAGGTTAGAAGCAGCATTAAGAGGTCTTCTGGGAGCCTTAACAAGTACCCCATATTCTCCCACCCAGCATCTAGAGCGAGAGCAGGCTCTTGCTAAACAGTTTGCAGAAATTCTTCATTTCACACTCCGGTTTGATGAACTCAAGATGACAAATCCTGCCATACAGAATGATTTCAGCTATTATAGAAGAACATTGAGTCGTATGAGGATTAACAATGTACCGGCAGAAGGAGAAAATGAAGTAAATAATGAATTGGCAAATCGAATGTCTTTGTTTTATGCTGAGGCAACTCCAATGCTGAAAACCTTGAGTGATGCCACAACAAAATTTGTATCAGAGAATAAAAATTTACCAATAGAAAATACCACAGATTGTTTAAGCACAATGGCTAGTGTATGCAGAGTCATGCTGGAAACACCGGAATACAGAAGCAGATTTACAAATGAAGAGACAGTGTCATTCTGCTTGAGGGTAATGGTGGGTGTCATAATACTCTATGACCACGTACATCCAGTGGGAGCATTTGCTAAAACTTCCAAAATTGATATGAAAGGTTGTATCAAAGTTCTTAAGGACCAACCTCCTAATAGTGTGGAAGGTCTTCTAAATGCTCTCAGGTACACAACAAAACATTTGAATGATGAGACTACCTCCAAGCAAATTAAATCCATGCTGCAATAACAATTCTGGAATAAGCACCTGCTGTAGACAGAAGACAGTATTCTGCAATGACTGAGAATGCAGTTTTTTAGTGATTGCAATTACTATCTCATTTATTCTTGCTTTTATTTCTTTCCTCTGTTCCTCTTCCCTCTTTTTTAATCATGTTCTTAAGACTTCTTTTCTGTGCCAAAATCAGTAAAGTTACACTCTGAAGGGATATCATCCTTTCAAACGGGCCATCTAAGGCAGCTAATTATGCATTGCATTGGGGTCTCTACTGAGAAAAATTCTGTGACTTGAACTAAATATTTTTAAATGTGGATTTTTTTTGAAACTAATATTTAATATTGCTTCTCCTGCATGGCAAAACTGCCTATTCTGCTATTTAAAAACCCTCAATGACTTTATTTTCTACTGCCGCCTTTTTCATGTGCAACCAAAATGAAAATGTTTAAATTAACTGTGTTGTACAAATGGTACCCAACACAAACTTTTTTTAAATTAGTAATACTTTTGTTTAAAGTTTTAAGTTTGCATTTTGACTTTTTTTGTAAGGATGTATGTTGTGTGTTTAACCTTTATTAACTAACGTTAAAAGCTGTGATGTGTGCGTAGAATATTACGTATGCATGTTCATGTCTAAAGAATGGCTGTTGATGATAAAATAAAAATCAGCTTTCATTTTTCTAAGTGTGGCTTGGTTTACTGATGTTTTGTTTTTAGGCTTCTGAAGTTTTCCCCATGTATGTTTTTATGGAATGCATATATACATTACATGATTTTTTCTTCTTTTAGGGGAGAGCCGGGTCTTTTCATTAGAATTTTGATCATTGTCTATGTATATACTTTTAATTGCCTTTAAAATTTTGCTAAGTATATTAAGACCAGTGATCTTTTCATTAACTGGACTTTTATTCTTGATTTACTCTTGTATGGATGTAGTAATGGAAGGAAAACCGCATCCTTGCTTGATTCTCCATTTCCAGGGGAGCGGGTAGCAACATGAAGGCAGAGTAGCCCTTTAATCATGGGAAGAGAGTGATTATAAGAGGGACTTCCCAGGAGAAAAGCAGAGGCCATGATCTCACTAGTGGTAGAAAACTAACAGGTTTCAGTTTAAGATCATAAAACCTAAATCATGAAATCTAAATCTCATGGTTGGAACAAACTACTTAAAGGTTGTCTAGTTCAACCATGCCAGTGTTTTAAATATTTAGGAATATCCGAGGTATAATACAATTAAAATGTTTAACCATGGAAGAGAATCACAGAGGCTTCCATCAGACCCTTCTGGATTAATAGGGCCAGATCATGGCACACACAGCTTCTCAAGATCACATCCCTGCTGATCTCTCTGGCCCTCCTGATCACTGCTCCCCCACTTCACACCCTGTCCTGCAGCCAGGCCCTACTGCTTGCTGTTCACAAATTGTTCCATGTGATGTCACTTCCTTAGCTCTGGTCTGGCTGGTCCCTGAACCTGACATTCCCTTCCTCCCCTTGTGACCCTCTAATGAACGCCAACTTTCATCTTTGAAGGGTTAGCTTCTATTACCTCCTTCATGAAGCCTTCTGGATAACATTGGCCATATCCTTCTAGGCATCTTCTAAGAATAGTGTAATAGGCTGAATAGTGGCCCCCAGGAGATACATTCACTGGGAATCTCCACGTGTGACATTATTTGGAAAAAGTTTTTGCAGATGAAATCAAGGACCTGGAAATGAGATCAACCTGTAGTAGGGTGGGCCCTAAATTCAATGACTAGCTCTTAGAAAAGAAGGGGAAATAGACACACAGAGCTGAAGGCCATGGGAAGATGGAGGCAGAGATTAGAGCAATGCATCTATGAGCCAAAGAACCCTAAGAATTGGAGGAAGTCACTAGAAGCTAGGAAAACAGGCATGTCACAGATTCTCCCTCAGAGTCTCGAGAAGGAACCAACCCTACCAATATCTTGATTTCAGACATCTGGCCTCCAGGATTGTGAGGGAATAAATTTCTGTTGTTTTAAGCCATGCAGTTTGTGGTATTTTGGTACAGCAGCCTTAAGAATCTGATACATGTATCTCGTAAAACACCTCTGATACTTACCTGCGCTTGTGGCTGTGTTTTCTGATACTATGAGAGCCGTAGTATCTGGATACCGGAGAGTCTGCGAACTTGAGAGAAGGGCCGTGTCTGATTTTCCTTCAGTGTCCCAAGGAAGGATCTTGCACAGTACCCAGATTTGGAGAGGTGCCAAGTGAATGCTTCGGTGGACTGAATGAATACAAATCAAAAATAATGATGCAGCGGGAATGGATGCAGTAAGATTGCTGTGGCCTATGCAGTTCACACAGTTCACACTCTGCATGTTGAGGAGTAAGTGGACAGATCTCTTAAGCCCAGGGGCTAGCAAACCGGTCTGTGGGCCAATTTACTCACCGTCTGTTTTTGTACAGCTTGTGAGCTAAAAATGGTTTTTAAAAAGGTTGAATACAATCAAAAGAATAATATTTTGTGGCATGAGAAAAGCATATGAAATTCAAATTTTAGTGTTCATAAATAAAATTTTATTGGAACC